Incidental Mutation 'R5026:Tial1'
ID475483
Institutional Source Beutler Lab
Gene Symbol Tial1
Ensembl Gene ENSMUSG00000030846
Gene NameTia1 cytotoxic granule-associated RNA binding protein-like 1
SynonymsmTIAR, 5330433G13Rik, TIAR
MMRRC Submission 042617-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.709) question?
Stock #R5026 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128439777-128461717 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 128448396 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 82 (E82K)
Ref Sequence ENSEMBL: ENSMUSP00000145908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033135] [ENSMUST00000106226] [ENSMUST00000106228] [ENSMUST00000123666] [ENSMUST00000133444] [ENSMUST00000141126] [ENSMUST00000165023] [ENSMUST00000205278] [ENSMUST00000205835]
Predicted Effect probably benign
Transcript: ENSMUST00000033135
AA Change: E77K

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033135
Gene: ENSMUSG00000030846
AA Change: E77K

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106226
AA Change: E94K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101833
Gene: ENSMUSG00000030846
AA Change: E94K

DomainStartEndE-ValueType
RRM 10 98 7.41e-18 SMART
RRM 115 188 2.76e-26 SMART
RRM 223 290 1.19e-16 SMART
low complexity region 360 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106228
AA Change: E38K

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101835
Gene: ENSMUSG00000030846
AA Change: E38K

DomainStartEndE-ValueType
Pfam:RRM_1 11 50 1.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123666
AA Change: E77K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116921
Gene: ENSMUSG00000030846
AA Change: E77K

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
Pfam:RRM_1 99 132 1.3e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133089
Predicted Effect probably benign
Transcript: ENSMUST00000133444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141079
Predicted Effect probably benign
Transcript: ENSMUST00000141126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152328
Predicted Effect probably benign
Transcript: ENSMUST00000165023
AA Change: E77K

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126458
Gene: ENSMUSG00000030846
AA Change: E77K

DomainStartEndE-ValueType
RRM 10 81 3.2e-22 SMART
RRM 98 171 2.76e-26 SMART
RRM 206 273 1.19e-16 SMART
low complexity region 343 366 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205278
AA Change: E82K

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205774
Predicted Effect probably benign
Transcript: ENSMUST00000205835
Meta Mutation Damage Score 0.1246 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 90.7%
Validation Efficiency 96% (88/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of RNA-binding proteins, has three RNA recognition motifs (RRMs), and binds adenine and uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes. It regulates various activities including translational control, splicing and apoptosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. The different isoforms have been show to function differently with respect to post-transcriptional silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit partial embryonic lethality and reduced postnatal survival, reduced embryonic and postnatal body weight, and male and female sterility. Infertility is owed to a substantial decrease in the survival of primordial germ cells atthe genital ridge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,317,224 N608S probably benign Het
Actg1 T C 11: 120,346,958 N7S probably damaging Het
Adamtsl3 T A 7: 82,576,054 L357Q probably benign Het
Ahnak A T 19: 9,010,631 Q3093L possibly damaging Het
Ankrd16 T A 2: 11,789,881 V359E probably benign Het
Ankrd40 T C 11: 94,339,724 probably benign Het
Ano10 G A 9: 122,272,559 Q49* probably null Het
Aoah A T 13: 20,914,959 D236V probably damaging Het
Bin1 T C 18: 32,419,930 probably null Het
Braf T C 6: 39,688,287 D49G probably benign Het
Brsk1 A T 7: 4,704,266 R273W probably damaging Het
C2cd3 T A 7: 100,459,842 M2259K possibly damaging Het
Cabp1 T C 5: 115,175,472 N43D possibly damaging Het
Ccar2 T A 14: 70,142,502 Q412L possibly damaging Het
Cd4 T C 6: 124,866,620 T443A possibly damaging Het
Cdh23 T A 10: 60,304,848 I3206F possibly damaging Het
Ceacam9 A T 7: 16,725,197 probably null Het
Chid1 T C 7: 141,513,836 D289G probably damaging Het
Chmp6 T A 11: 119,918,643 L196Q probably damaging Het
Cog8 A G 8: 107,049,125 S536P probably benign Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah7a T G 1: 53,662,498 Y166S probably damaging Het
Dnah7b G T 1: 46,187,363 W1318L probably damaging Het
Ecd A G 14: 20,337,030 F212S probably damaging Het
Entpd6 A T 2: 150,763,644 S265C probably damaging Het
Epb41l2 A G 10: 25,484,308 T523A possibly damaging Het
Focad T C 4: 88,344,582 S939P unknown Het
Gjb3 A T 4: 127,326,487 V84D probably damaging Het
Gm572 A T 4: 148,654,844 E43V possibly damaging Het
Gm6185 T A 1: 161,224,608 noncoding transcript Het
Gria1 T A 11: 57,310,696 C787S probably damaging Het
Grpel2 A G 18: 61,715,953 L162P probably damaging Het
Herc1 A G 9: 66,486,126 T4096A probably benign Het
Hook3 A T 8: 26,110,757 M41K probably damaging Het
Ifit1bl1 T C 19: 34,593,893 Y388C probably damaging Het
Ighv3-4 A G 12: 114,253,762 Y70H probably benign Het
Itm2c T C 1: 85,906,492 L176P probably damaging Het
Lmtk3 G A 7: 45,794,412 probably benign Het
Macf1 G A 4: 123,439,494 T2376I possibly damaging Het
Map1a T G 2: 121,307,538 S2660A possibly damaging Het
Mmrn2 A G 14: 34,399,201 H676R probably benign Het
Nbeal1 A T 1: 60,237,179 K693M probably damaging Het
Ndufa13 T A 8: 69,895,270 R49* probably null Het
Neb T A 2: 52,204,880 T1115S possibly damaging Het
Nvl C T 1: 181,105,155 R699H probably damaging Het
Olfr1490 A G 19: 13,654,932 I163V probably benign Het
Olfr74 A T 2: 87,974,020 I215N probably damaging Het
Olfr920 A G 9: 38,755,745 D19G probably benign Het
Olfr926 A T 9: 38,877,899 H241L possibly damaging Het
Piezo1 G T 8: 122,486,818 D1779E probably benign Het
Prl8a9 A G 13: 27,561,577 S77P probably damaging Het
Prune2 A T 19: 17,199,142 I2904F probably damaging Het
Retreg1 T A 15: 25,970,128 S151T probably damaging Het
Rnf213 A G 11: 119,436,764 D1859G probably damaging Het
Rnf39 T C 17: 36,945,534 F173L probably benign Het
Rspry1 T A 8: 94,650,303 N371K probably damaging Het
Samd9l T A 6: 3,375,284 D659V possibly damaging Het
Sez6 T A 11: 77,968,989 F378Y probably damaging Het
Slc22a19 G A 19: 7,674,372 T490M probably benign Het
Slit2 A T 5: 48,256,805 N917I probably damaging Het
Smg1 T A 7: 118,193,545 probably benign Het
Tes T C 6: 17,096,340 V24A probably benign Het
Tmem94 G A 11: 115,793,104 C750Y probably damaging Het
Tmppe T A 9: 114,405,819 N395K possibly damaging Het
Tnn T C 1: 160,146,137 H220R probably benign Het
Trappc10 T C 10: 78,204,288 T610A possibly damaging Het
Trmt1l T A 1: 151,440,876 M196K probably damaging Het
Trpv4 T C 5: 114,622,654 *872W probably null Het
Ttn T C 2: 76,749,009 T23847A probably benign Het
Ube4b T A 4: 149,360,565 L440F probably damaging Het
Ugt1a5 C G 1: 88,166,241 R64G probably benign Het
Unc13c T A 9: 73,930,903 T889S possibly damaging Het
Vmn1r215 C T 13: 23,076,279 T163I probably benign Het
Vmn2r16 T A 5: 109,360,856 Y483* probably null Het
Wdr47 T A 3: 108,618,522 C120* probably null Het
Zc3h6 G A 2: 129,017,309 V1087I probably benign Het
Zfp423 T C 8: 87,780,674 H889R probably damaging Het
Zfp825 G T 13: 74,481,077 H107N probably benign Het
Zfp945 T C 17: 22,850,885 H680R probably damaging Het
Other mutations in Tial1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Tial1 APN 7 128448345 missense probably damaging 1.00
IGL02623:Tial1 APN 7 128443883 missense probably benign 0.12
IGL02936:Tial1 APN 7 128442663 splice site probably benign
R0798:Tial1 UTSW 7 128443878 missense probably benign 0.04
R1583:Tial1 UTSW 7 128443910 missense probably damaging 1.00
R1913:Tial1 UTSW 7 128444659 missense probably damaging 1.00
R4863:Tial1 UTSW 7 128455028 missense probably damaging 1.00
R5039:Tial1 UTSW 7 128443968 intron probably benign
R5629:Tial1 UTSW 7 128444697 missense probably damaging 0.97
R6697:Tial1 UTSW 7 128444869 missense possibly damaging 0.94
R8072:Tial1 UTSW 7 128442470 missense unknown
R8178:Tial1 UTSW 7 128444890 missense probably benign 0.01
R8937:Tial1 UTSW 7 128454991 missense probably damaging 1.00
Z1177:Tial1 UTSW 7 128442639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CATGGAAGTGATCTGAAATCAAAGC -3'
(R):5'- CCAGTGACTGTCTATGTTTGCATG -3'

Sequencing Primer
(F):5'- GTGATCTGAAATCAAAGCATTTGG -3'
(R):5'- GACTGTCTATGTTTGCATGTTAAATC -3'
Posted On2017-04-28