Incidental Mutation 'R5275:Ppan'
ID475485
Institutional Source Beutler Lab
Gene Symbol Ppan
Ensembl Gene ENSMUSG00000004100
Gene Namepeter pan homolog
SynonymsSSF1, A230087P06Rik
MMRRC Submission 042838-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5275 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20888175-20892178 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 20889773 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 115 (Y115*)
Ref Sequence ENSEMBL: ENSMUSP00000149658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004203] [ENSMUST00000004206] [ENSMUST00000214331]
Predicted Effect probably null
Transcript: ENSMUST00000004203
AA Change: Y115*
SMART Domains Protein: ENSMUSP00000004203
Gene: ENSMUSG00000004100
AA Change: Y115*

DomainStartEndE-ValueType
Brix 32 286 1.13e-77 SMART
Blast:Brix 321 429 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000004206
SMART Domains Protein: ENSMUSP00000004206
Gene: ENSMUSG00000070319

DomainStartEndE-ValueType
Pfam:eIF3g 56 175 5.5e-45 PFAM
RRM 240 313 1.49e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157047
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158946
Predicted Effect probably null
Transcript: ENSMUST00000214331
AA Change: Y115*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an evolutionarily conserved protein similar to yeast SSF1 as well as to the gene product of the Drosophila gene peter pan (ppan). SSF1 is known to be involved in the second step of mRNA splicing. Both SSF1 and ppan are essential for cell growth and proliferation. Exogenous expression of this gene was reported to reduce the anchorage-independent growth of some tumor cells. Read-through transcription of this gene with P2RY11/P2Y(11), an adjacent downstream gene that encodes an ATP receptor, has been found. These read-through transcripts are ubiquitously present and up-regulated during granulocyte differentiation. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,235,659 R155H probably benign Het
Abcc1 C T 16: 14,466,186 L1222F probably damaging Het
Alpl T C 4: 137,749,608 T245A probably benign Het
Ank2 T C 3: 127,032,183 H378R probably damaging Het
Apold1 G T 6: 134,983,800 L72F probably damaging Het
Arhgef1 G A 7: 24,919,352 probably null Het
Atp5c1 T C 2: 10,068,733 R10G possibly damaging Het
Ccr10 C T 11: 101,174,285 V140M possibly damaging Het
Cep135 T A 5: 76,593,204 H42Q possibly damaging Het
Chd6 A G 2: 160,969,363 L1440P probably benign Het
Clca3a2 A G 3: 144,813,579 S279P probably damaging Het
Cma1 A T 14: 55,941,700 I233N probably damaging Het
Dnajc16 T C 4: 141,767,928 E493G possibly damaging Het
Dst T C 1: 34,180,148 S1890P probably benign Het
Ears2 T C 7: 122,048,198 R288G probably damaging Het
Elovl4 G A 9: 83,780,661 P273L possibly damaging Het
Fryl T C 5: 73,112,791 Y79C probably damaging Het
Gad1-ps A G 10: 99,444,889 noncoding transcript Het
Gm38100 A G 1: 175,920,770 H134R probably benign Het
Gm5117 T A 8: 31,739,567 noncoding transcript Het
Gm8882 T G 6: 132,361,877 Q126P unknown Het
Gm8909 T C 17: 36,161,675 probably null Het
Lmtk3 G A 7: 45,791,298 D243N probably damaging Het
Lsm7 T C 10: 80,854,620 E32G probably damaging Het
Olfr1309 T A 2: 111,983,829 I82F probably damaging Het
Olfr1344 A T 7: 6,440,016 T39S probably benign Het
Olfr728 T A 14: 50,140,496 I48F probably benign Het
Opa1 C T 16: 29,611,579 T451I probably damaging Het
Pcdh12 T A 18: 38,284,101 probably benign Het
Perm1 T C 4: 156,217,518 L173P probably benign Het
Plvap T C 8: 71,511,670 Q16R probably benign Het
Prl7d1 A T 13: 27,709,247 V227D probably damaging Het
Prss54 T C 8: 95,564,478 T165A probably damaging Het
Psrc1 A G 3: 108,386,359 I195V probably benign Het
Ptpn20 A G 14: 33,631,192 H296R probably benign Het
Rergl A G 6: 139,501,821 probably null Het
Rnf123 AT ATT 9: 108,064,003 probably null Het
Scfd1 A T 12: 51,415,589 H409L probably benign Het
Serpina3c T C 12: 104,148,378 E333G probably damaging Het
Serpinb6c A G 13: 33,893,817 F190S probably damaging Het
Slc24a5 C T 2: 125,085,861 T360I probably benign Het
Snx6 T C 12: 54,784,022 H51R probably damaging Het
Sorl1 A T 9: 42,030,902 V1009D probably benign Het
Tdh T C 14: 63,496,109 Y110C probably damaging Het
Tdrd9 T A 12: 112,051,912 L1255* probably null Het
Tlk1 C T 2: 70,752,205 probably benign Het
Tnc G A 4: 63,964,730 Q1885* probably null Het
Vcl T C 14: 21,010,078 V595A probably damaging Het
Vmn1r84 A T 7: 12,361,814 N305K probably benign Het
Zbtb2 T C 10: 4,368,508 K506R probably damaging Het
Other mutations in Ppan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01910:Ppan APN 9 20890936 missense probably damaging 1.00
IGL03162:Ppan APN 9 20891312 missense probably damaging 1.00
R0279:Ppan UTSW 9 20891529 missense probably benign 0.01
R1382:Ppan UTSW 9 20891918 missense probably benign 0.08
R4406:Ppan UTSW 9 20890992 missense probably damaging 1.00
R4724:Ppan UTSW 9 20888510 missense probably benign 0.04
R5217:Ppan UTSW 9 20890925 missense possibly damaging 0.46
R5946:Ppan UTSW 9 20889673 nonsense probably null
R6540:Ppan UTSW 9 20891210 splice site probably null
R7131:Ppan UTSW 9 20891154 missense possibly damaging 0.94
R7227:Ppan UTSW 9 20888200 unclassified probably benign
R7419:Ppan UTSW 9 20891844 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTGAAGGAGCAGGGCTTTC -3'
(R):5'- CGTAACATGTGGTCTGCTCC -3'

Sequencing Primer
(F):5'- CGCCAGCCAGACCCCTG -3'
(R):5'- AGCTGTCACAGATCTGGCC -3'
Posted On2017-04-28