Incidental Mutation 'R5303:Cd1d1'
ID475491
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene NameCD1d1 antigen
SynonymsCD1.1, Cd1d, Cd1a, Ly-38
MMRRC Submission 042886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5303 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location86995834-86999441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86998120 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 189 (F189L)
Ref Sequence ENSEMBL: ENSMUSP00000029717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
Predicted Effect probably benign
Transcript: ENSMUST00000029717
AA Change: F189L

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: F189L

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142793
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik C G 3: 124,406,350 G531A probably damaging Het
2410089E03Rik G A 15: 8,260,690 probably null Het
4921504E06Rik A G 2: 19,516,299 Y256H possibly damaging Het
Abcc12 C A 8: 86,509,786 R1133L probably benign Het
Acss3 T A 10: 107,084,851 T133S possibly damaging Het
Adra1d G A 2: 131,546,249 P462L possibly damaging Het
Ank2 A T 3: 126,945,804 probably benign Het
Arid2 G A 15: 96,392,468 R1748Q probably damaging Het
B3glct C T 5: 149,754,023 probably benign Het
C3ar1 A T 6: 122,849,835 S474R probably damaging Het
Cd46 T C 1: 195,062,399 I344V probably benign Het
Chrna1 T C 2: 73,566,274 M426V probably benign Het
Cinp G A 12: 110,876,861 T139M probably damaging Het
Disp2 T C 2: 118,810,848 probably benign Het
Eapp G A 12: 54,692,918 P38L probably damaging Het
Eif4g3 T C 4: 138,126,562 S480P probably benign Het
Epb41l3 G C 17: 69,257,449 E390Q probably damaging Het
Fermt1 T C 2: 132,911,339 probably null Het
Foxf2 T A 13: 31,626,480 F134Y possibly damaging Het
Foxp2 T A 6: 15,324,637 C95S probably benign Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gria1 A G 11: 57,243,025 T577A probably benign Het
Hal A G 10: 93,516,365 probably benign Het
Hdac7 C A 15: 97,798,018 E670D probably damaging Het
Islr2 A T 9: 58,208,275 probably benign Het
Itpr3 T C 17: 27,116,689 Y2258H probably benign Het
Mical3 G T 6: 120,959,980 T1195K probably benign Het
Myh1 T C 11: 67,202,017 S46P probably benign Het
Mylk3 T A 8: 85,350,476 I444F probably damaging Het
Nlrc3 A T 16: 3,963,614 C644S probably benign Het
Notch1 C T 2: 26,478,619 V553M probably benign Het
Olfr1245 T A 2: 89,575,001 I242F possibly damaging Het
Olfr1454 T A 19: 13,063,775 Y121* probably null Het
Olfr644 T C 7: 104,069,032 probably benign Het
Olfr979 A G 9: 40,000,588 I213T probably damaging Het
Pih1d3 G A 1: 31,223,456 R173H probably damaging Het
Postn A G 3: 54,377,597 T669A probably damaging Het
Ppp5c G T 7: 17,005,284 Q472K probably benign Het
Qsox1 T C 1: 155,779,293 H708R probably benign Het
Rhbdl2 A G 4: 123,810,221 probably benign Het
Ryr1 C T 7: 29,068,482 E2884K probably damaging Het
Saysd1 T C 14: 20,082,958 T44A probably benign Het
Sept14 T A 5: 129,689,648 M290L possibly damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc38a8 C A 8: 119,486,041 V294L possibly damaging Het
Spdye4b C T 5: 143,202,403 T217I probably benign Het
Sugp2 T A 8: 70,242,177 probably benign Het
Syne1 T C 10: 5,420,464 T232A probably benign Het
Tbc1d5 A T 17: 50,736,200 D753E probably benign Het
Tmed1 G T 9: 21,510,047 Q44K possibly damaging Het
Ttc6 T A 12: 57,575,820 S2T possibly damaging Het
Ube4b T C 4: 149,383,803 D172G probably damaging Het
Vmn1r235 C A 17: 21,262,006 Q198K probably benign Het
Wdfy3 T C 5: 101,952,983 H256R probably damaging Het
Zfat A T 15: 68,110,486 H1059Q probably damaging Het
Zfp758 A G 17: 22,374,861 I77M probably benign Het
Zfp850 C T 7: 28,008,413 A2T probably damaging Het
Zfyve1 A T 12: 83,575,056 N188K probably damaging Het
Zyg11a C T 4: 108,184,432 probably null Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86998173 missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86996588 missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86998881 missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86998161 missense probably benign
R0350:Cd1d1 UTSW 3 86997573 missense probably benign 0.11
R1771:Cd1d1 UTSW 3 86998665 missense possibly damaging 0.85
R2407:Cd1d1 UTSW 3 86998182 missense probably damaging 1.00
R3906:Cd1d1 UTSW 3 86998756 missense probably damaging 1.00
R4540:Cd1d1 UTSW 3 86996705 missense probably benign 0.21
R4976:Cd1d1 UTSW 3 86998651 missense probably benign 0.00
R5786:Cd1d1 UTSW 3 86998788 missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86998702 missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86998257 missense probably benign 0.00
R7315:Cd1d1 UTSW 3 86998113 missense possibly damaging 0.80
R7787:Cd1d1 UTSW 3 86997596 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAATTTATAGAACCCAAGAGTGGC -3'
(R):5'- TGTACCCTGGGAATGCTTCG -3'

Sequencing Primer
(F):5'- ACCCAAGAGTGGCTGTCAGTG -3'
(R):5'- CGGAAAGCTTTTTACACGTAGC -3'
Posted On2017-05-02