Mutagenetix > Incidental Mutation

Incidental Mutation 'R0506:Zer1'

47550

Institutional Source

Beutler Lab

Gene Symbol

Zer1

Ensembl Gene

ENSMUSG00000039686

Gene Name

zyg-11 related, cell cycle regulator

Synonyms

C230075L19Rik, Zyg11bl

MMRRC Submission

038701-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R0506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30097283-30124585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30101807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 680 (I680N)

Ref Sequence

ENSEMBL: ENSMUSP00000046441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]

AlphaFold

Q80ZJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000044751
AA Change: I680N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: I680N

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	405	774	3e-15	SMART
Blast:ARM	440	480	2e-18	BLAST
Blast:ARM	524	569	4e-24	BLAST
Blast:ARM	571	613	6e-22	BLAST
Blast:ARM	617	656	7e-8	BLAST
Blast:ARM	686	724	6e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000113677
AA Change: I667N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: I667N

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	392	761	3e-15	SMART
Blast:ARM	427	467	2e-18	BLAST
Blast:ARM	511	556	4e-24	BLAST
Blast:ARM	558	600	2e-21	BLAST
Blast:ARM	604	643	7e-8	BLAST
Blast:ARM	673	711	6e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152068

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152285

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154231

Meta Mutation Damage Score

0.9672

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,538,096	C378*	probably null	Het
Ago3	T	C	4: 126,417,252	D56G	possibly damaging	Het
Ahnak	G	T	19: 9,009,128	G2592V	probably damaging	Het
Aldh6a1	C	T	12: 84,433,526	G470D	probably damaging	Het
Ankub1	T	A	3: 57,690,375	N58I	probably damaging	Het
Apol7b	G	T	15: 77,425,528	T23K	probably benign	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Arhgap24	T	C	5: 102,875,777	Y136H	probably damaging	Het
Atp1a1	A	G	3: 101,589,812	F393L	probably damaging	Het
Bcdin3d	A	T	15: 99,470,992	C109S	probably damaging	Het
Catsperd	A	G	17: 56,658,078	K475R	possibly damaging	Het
Cblb	A	G	16: 52,204,480	T913A	probably benign	Het
Cbx6	A	G	15: 79,828,203	L341P	probably benign	Het
Cd177	T	C	7: 24,758,356	Y159C	probably damaging	Het
Cdh7	A	G	1: 110,100,114	N530D	probably damaging	Het
Cdk8	T	C	5: 146,298,872	F270L	probably damaging	Het
Ces2c	A	T	8: 104,848,024	T38S	probably damaging	Het
Chst14	T	C	2: 118,927,721	L357P	probably damaging	Het
Clca3b	T	A	3: 144,822,866		probably benign	Het
Cluh	A	G	11: 74,664,894	S839G	probably benign	Het
Cnga4	T	A	7: 105,407,740	V350E	probably damaging	Het
Creb1	G	A	1: 64,570,267	G180R	probably damaging	Het
Csmd3	T	C	15: 48,457,511	E301G	probably benign	Het
Cyp4f18	A	T	8: 71,996,000	D268E	probably benign	Het
Dock5	A	G	14: 67,784,792		probably benign	Het
Dpy19l4	T	A	4: 11,289,715	H332L	probably benign	Het
Dync2h1	T	A	9: 7,113,153	H224L	probably benign	Het
Dzip1l	C	A	9: 99,663,081	Q585K	possibly damaging	Het
Erf	C	T	7: 25,244,376	G510D	probably damaging	Het
Fanci	T	C	7: 79,432,178	L623P	probably benign	Het
Fat1	T	C	8: 45,022,951	V1655A	probably damaging	Het
Fat4	T	C	3: 38,888,314	V452A	probably benign	Het
Gal3st4	C	T	5: 138,265,889	G283S	probably benign	Het
Gm5422	A	G	10: 31,250,322		noncoding transcript	Het
Gnal	C	T	18: 67,088,673	T49I	unknown	Het
Gng5	A	G	3: 146,503,348	N57S	probably damaging	Het
Herc1	A	G	9: 66,448,159	I2231V	probably damaging	Het
Hgfac	G	T	5: 35,044,240	G272W	probably damaging	Het
Hmcn1	T	A	1: 150,742,341	D1265V	possibly damaging	Het
Ifi207	T	A	1: 173,736,312	Q47L	possibly damaging	Het
Klhl40	G	A	9: 121,778,067	E98K	probably damaging	Het
Lepr	G	T	4: 101,773,010		probably benign	Het
Lyst	A	G	13: 13,638,015	H1004R	probably benign	Het
Map3k1	T	A	13: 111,755,764	R986*	probably null	Het
Mmp1b	C	A	9: 7,387,013	Q66H	possibly damaging	Het
Mpo	T	C	11: 87,803,504	S107P	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Myo7b	A	G	18: 31,964,386		probably null	Het
Myom1	T	C	17: 71,092,220		probably benign	Het
Nalcn	C	T	14: 123,596,614	V50I	possibly damaging	Het
Negr1	A	G	3: 157,160,748		probably benign	Het
Nlrc5	T	G	8: 94,493,125		probably benign	Het
Nyap2	G	A	1: 81,087,312	D14N	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1490	T	A	19: 13,654,897	I151N	possibly damaging	Het
Olfr91	C	A	17: 37,093,311	G188W	probably damaging	Het
Parp14	A	T	16: 35,841,409	S1419T	possibly damaging	Het
Piezo2	A	G	18: 63,027,544	F2347S	probably damaging	Het
Pigf	A	G	17: 87,008,909	V147A	probably benign	Het
Pkhd1	A	T	1: 20,559,469	M637K	probably benign	Het
Plce1	T	C	19: 38,760,138	I1771T	probably benign	Het
Ppp6c	A	T	2: 39,206,648		probably benign	Het
Prag1	T	C	8: 36,103,700	V479A	possibly damaging	Het
Prss33	A	T	17: 23,835,105	D42E	probably benign	Het
Psmb10	A	G	8: 105,937,545	V64A	possibly damaging	Het
Psmd14	A	G	2: 61,800,063	T306A	probably benign	Het
Psmg1	C	T	16: 95,989,487		probably benign	Het
Rc3h2	A	T	2: 37,376,659		probably null	Het
Reln	C	T	5: 21,920,496	V2730I	probably damaging	Het
Sec24a	A	T	11: 51,743,795	H101Q	probably benign	Het
Selenoi	A	G	5: 30,266,956	N385S	probably benign	Het
Slc24a4	T	C	12: 102,131,623		probably null	Het
Slc4a10	G	A	2: 62,250,533	S338N	probably benign	Het
Slfn3	A	T	11: 83,213,160	T286S	probably damaging	Het
Snx29	A	G	16: 11,395,303	D111G	probably benign	Het
Sp8	T	C	12: 118,848,565	S52P	possibly damaging	Het
Srek1	G	T	13: 103,760,590	T81K	probably damaging	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tatdn2	C	A	6: 113,702,589	D298E	probably benign	Het
Tmem253	A	T	14: 52,017,206		probably benign	Het
Tmem63a	T	A	1: 180,958,049		probably null	Het
Tmprss11b	T	C	5: 86,661,640	D331G	probably damaging	Het
Tor1aip1	T	A	1: 156,007,674	K143*	probably null	Het
Trappc8	A	T	18: 20,844,188	N841K	possibly damaging	Het
Trio	T	C	15: 27,854,963	Q711R	probably benign	Het
Trmt10b	C	A	4: 45,304,306	T114N	probably damaging	Het
Trpv2	C	A	11: 62,582,906	A129D	probably benign	Het
Ttll4	T	G	1: 74,688,618	D846E	probably benign	Het
Ugt2a3	A	G	5: 87,336,649	L172P	possibly damaging	Het
Usp19	T	A	9: 108,494,487	F355Y	probably damaging	Het
Vmn1r209	C	T	13: 22,805,944	G192D	probably damaging	Het
Vmn2r107	T	G	17: 20,357,759	D443E	probably benign	Het
Wee2	A	T	6: 40,463,253	E445V	probably benign	Het
Zfhx4	T	C	3: 5,402,735	L2651P	probably damaging	Het
Zfp692	C	T	11: 58,309,055	Q157*	probably null	Het
Zfp964	T	A	8: 69,663,937	C396S	unknown	Het

Other mutations in Zer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Zer1	APN	2	30108220	critical splice donor site	probably null
IGL01630:Zer1	APN	2	30101831	missense	probably damaging	1.00
IGL02126:Zer1	APN	2	30104916	missense	probably benign	0.10
IGL02338:Zer1	APN	2	30113393	missense	probably damaging	1.00
IGL02817:Zer1	APN	2	30103394	missense	probably damaging	0.99
PIT4402001:Zer1	UTSW	2	30101120	missense	probably damaging	0.96
PIT4495001:Zer1	UTSW	2	30103543	missense	probably benign	0.01
R0390:Zer1	UTSW	2	30108213	splice site	probably benign
R0606:Zer1	UTSW	2	30104797	splice site	probably benign
R0928:Zer1	UTSW	2	30101763	critical splice donor site	probably null
R1167:Zer1	UTSW	2	30108246	missense	probably benign	0.00
R1819:Zer1	UTSW	2	30110218	missense	probably benign	0.18
R2040:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2041:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2042:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2092:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2168:Zer1	UTSW	2	30104875	missense	probably damaging	1.00
R2243:Zer1	UTSW	2	30101127	missense	probably damaging	0.99
R2254:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2255:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2311:Zer1	UTSW	2	30101822	missense	probably damaging	0.99
R2993:Zer1	UTSW	2	30101897	missense	probably damaging	1.00
R3010:Zer1	UTSW	2	30113285	missense	probably benign	0.13
R3731:Zer1	UTSW	2	30110911	missense	probably benign	0.44
R4038:Zer1	UTSW	2	30107523	missense	probably damaging	1.00
R5241:Zer1	UTSW	2	30104970	missense	probably damaging	1.00
R5433:Zer1	UTSW	2	30100986	intron	probably benign
R5443:Zer1	UTSW	2	30110996	missense	probably damaging	1.00
R5524:Zer1	UTSW	2	30104854	missense	probably damaging	1.00
R5936:Zer1	UTSW	2	30107667	missense	probably damaging	0.97
R5999:Zer1	UTSW	2	30104997	missense	probably damaging	1.00
R6598:Zer1	UTSW	2	30113274	missense	probably damaging	1.00
R6965:Zer1	UTSW	2	30101047	missense	possibly damaging	0.87
R7030:Zer1	UTSW	2	30111021	missense	probably benign	0.00
R7190:Zer1	UTSW	2	30103432	missense	probably damaging	1.00
R7218:Zer1	UTSW	2	30105012	missense	probably damaging	1.00
R7252:Zer1	UTSW	2	30101892	missense	probably damaging	0.99
R7383:Zer1	UTSW	2	30111241	missense	probably damaging	1.00
R7417:Zer1	UTSW	2	30102822	missense	probably damaging	1.00
R7459:Zer1	UTSW	2	30113325	missense	probably damaging	1.00
R7463:Zer1	UTSW	2	30113437	start gained	probably benign
R7466:Zer1	UTSW	2	30101484	splice site	probably null
R7477:Zer1	UTSW	2	30107976	missense	probably null	0.34
R7719:Zer1	UTSW	2	30111231	missense	probably damaging	1.00
R7813:Zer1	UTSW	2	30110373	missense	probably damaging	1.00
R7976:Zer1	UTSW	2	30107508	missense	probably damaging	0.99
R8239:Zer1	UTSW	2	30101135	critical splice acceptor site	probably null
R8350:Zer1	UTSW	2	30101850	missense	probably damaging	1.00
R8404:Zer1	UTSW	2	30105023	critical splice acceptor site	probably null
R8842:Zer1	UTSW	2	30111050	missense	possibly damaging	0.65
R8896:Zer1	UTSW	2	30103418	missense	probably damaging	0.99
R8906:Zer1	UTSW	2	30111023	missense	probably benign	0.31
R8929:Zer1	UTSW	2	30110869	missense	probably damaging	1.00
R9050:Zer1	UTSW	2	30111282	missense	probably damaging	1.00
R9066:Zer1	UTSW	2	30110674	missense	probably damaging	1.00
R9277:Zer1	UTSW	2	30111285	missense	probably benign	0.00
R9322:Zer1	UTSW	2	30110911	missense	probably benign	0.00
R9577:Zer1	UTSW	2	30101038	missense	probably damaging	1.00
R9733:Zer1	UTSW	2	30107631	missense	probably benign	0.00
X0026:Zer1	UTSW	2	30104895	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTTTACCATACACAGCGTGGCAG -3'
(R):5'- GCACACGCATGATGGATTTTCTCTC -3'

Sequencing Primer
(F):5'- TATGTAACATGCATAAGAGACAGGC -3'
(R):5'- GGATTTTCTCTCTCTTGGTAGCAAC -3'

Posted On

2013-06-12