Incidental Mutation 'R5333:Ogdh'
ID475512
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission 042915-MU
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5333 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6352126 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 850 (L850V)
Ref Sequence ENSEMBL: ENSMUSP00000080569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably damaging
Transcript: ENSMUST00000003461
AA Change: L854V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: L854V

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081894
AA Change: L850V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: L850V

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093350
AA Change: L865V

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: L865V

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000101554
AA Change: L854V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: L854V

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Meta Mutation Damage Score 0.5483 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,194,337 Y61N possibly damaging Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abca14 T A 7: 120,289,546 Y1238* probably null Het
Abcb5 A T 12: 118,867,942 V1225D probably damaging Het
Arhgef15 A G 11: 68,947,196 probably benign Het
As3mt A G 19: 46,708,196 R58G probably null Het
Asap1 T G 15: 64,127,414 N525T possibly damaging Het
Bhmt2 A G 13: 93,671,430 V50A probably benign Het
Ccdc180 A T 4: 45,890,935 I36F possibly damaging Het
Cd209c A G 8: 3,944,976 S63P probably damaging Het
Cdc37 T C 9: 21,143,161 E56G possibly damaging Het
Cdkal1 T C 13: 29,326,152 Y541C probably benign Het
Cenph G T 13: 100,761,772 H208N probably benign Het
Cfap65 A T 1: 74,903,175 L1740Q probably benign Het
Cfap74 A G 4: 155,436,740 D623G probably damaging Het
Ckap4 C A 10: 84,527,610 V530L probably damaging Het
Cldn13 A T 5: 134,915,015 N105K probably benign Het
Ddn T C 15: 98,805,356 D685G possibly damaging Het
Fam155a T A 8: 9,770,762 Q86L possibly damaging Het
Fdxr T C 11: 115,272,258 I70V probably benign Het
Fn1 A T 1: 71,624,180 Y1050N probably damaging Het
Impad1 A C 4: 4,767,963 V271G possibly damaging Het
Iqcf3 A G 9: 106,553,661 I96T possibly damaging Het
Itgax A G 7: 128,142,283 Y822C probably damaging Het
Katnb1 A T 8: 95,095,606 I286L possibly damaging Het
Lrp2 A C 2: 69,525,228 I424R probably benign Het
Lrpprc C A 17: 84,790,393 A41S probably benign Het
Mast3 A G 8: 70,783,501 L761P probably benign Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mpp4 C A 1: 59,157,441 R44L probably benign Het
Nkain3 T A 4: 20,484,889 M63L probably benign Het
Nup88 A C 11: 70,945,016 probably benign Het
Obscn A T 11: 59,062,692 C3837S probably damaging Het
Olfr1131 A G 2: 87,629,114 Y217C probably damaging Het
Olfr1293-ps A G 2: 111,527,703 I148V probably benign Het
Panx2 T C 15: 89,068,539 I411T possibly damaging Het
Papss1 T A 3: 131,643,044 M585K probably damaging Het
Pcbp2 T G 15: 102,486,021 L180R possibly damaging Het
Pcdha7 A T 18: 36,974,566 T215S probably benign Het
Pcdhga4 C T 18: 37,685,424 R9C probably benign Het
Plin4 A G 17: 56,104,970 V687A probably benign Het
Psma6 A G 12: 55,407,428 probably benign Het
Rcn1 A T 2: 105,389,126 S241T probably benign Het
Scgb2b18 A T 7: 33,173,275 L35H probably damaging Het
Slc11a1 A C 1: 74,384,145 D385A probably damaging Het
Stk31 T A 6: 49,469,152 C930S probably benign Het
Syt10 T A 15: 89,841,729 Q14L probably benign Het
Tnxb T G 17: 34,690,231 W1578G probably damaging Het
Triml1 C T 8: 43,130,290 A425T possibly damaging Het
Vil1 G A 1: 74,432,390 V777I probably benign Het
Vmn1r175 T C 7: 23,808,579 I208V possibly damaging Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0328:Ogdh UTSW 11 6347216 missense probably benign 0.01
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5592:Ogdh UTSW 11 6316763 splice site probably null
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
R8348:Ogdh UTSW 11 6342619 missense probably damaging 0.98
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCCTGGAGAGTAAACACCAG -3'
(R):5'- TCTAGAGGAACTTACAGTCTGAGATC -3'

Sequencing Primer
(F):5'- CCTGGAGAGTAAACACCAGAGGAG -3'
(R):5'- TCATGACTAAAAATCTAGAAAGAGCC -3'
Posted On2017-05-11