Incidental Mutation 'R5400:Cd69'
ID475515
Institutional Source Beutler Lab
Gene Symbol Cd69
Ensembl Gene ENSMUSG00000030156
Gene NameCD69 antigen
SynonymsVEA, AIM, 5830438K24Rik
MMRRC Submission 042971-MU
Accession Numbers

Genbank: NM_001033122; MGI: 88343

Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129267325-129275436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129269991 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 88 (M88L)
Ref Sequence ENSEMBL: ENSMUSP00000144734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032259] [ENSMUST00000204411]
Predicted Effect probably benign
Transcript: ENSMUST00000032259
AA Change: M129L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000032259
Gene: ENSMUSG00000030156
AA Change: M129L

DomainStartEndE-ValueType
Blast:CLECT 3 42 3e-8 BLAST
low complexity region 44 61 N/A INTRINSIC
CLECT 85 195 3e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203727
Predicted Effect probably benign
Transcript: ENSMUST00000204411
AA Change: M88L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000144734
Gene: ENSMUSG00000030156
AA Change: M88L

DomainStartEndE-ValueType
CLECT 44 154 1.5e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205190
Meta Mutation Damage Score 0.2519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in slightly increased pre-B and immature B cell numbers in the bone marrow, and increased IgG2a and IgM response to T cell-dependent and T cell-independent antigens. Mutant mice were less prone to collagen inducedarthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Neto1 A G 18: 86,395,908 H9R possibly damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Cd69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Cd69 APN 6 129268320 missense probably damaging 1.00
IGL02799:Cd69 APN 6 129268260 splice site probably benign
Jazzed UTSW 6 129269574 critical splice donor site probably null
Surrogate UTSW 6 129269580 missense probably benign 0.00
3-1:Cd69 UTSW 6 129275249 missense probably damaging 0.99
R0119:Cd69 UTSW 6 129270062 missense probably benign 0.01
R0136:Cd69 UTSW 6 129270062 missense probably benign 0.01
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R2327:Cd69 UTSW 6 129271388 missense probably damaging 1.00
R2352:Cd69 UTSW 6 129269604 missense probably damaging 1.00
R3955:Cd69 UTSW 6 129268380 splice site probably null
R4780:Cd69 UTSW 6 129271355 missense probably damaging 1.00
R5522:Cd69 UTSW 6 129271416 missense probably damaging 0.97
R6594:Cd69 UTSW 6 129269574 critical splice donor site probably null
R6737:Cd69 UTSW 6 129268299 missense probably benign 0.04
R6972:Cd69 UTSW 6 129269580 missense probably benign 0.00
R7240:Cd69 UTSW 6 129270042 missense possibly damaging 0.78
R7694:Cd69 UTSW 6 129270045 missense possibly damaging 0.91
Z1176:Cd69 UTSW 6 129268342 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGGGAGACTATACAGCAGAC -3'
(R):5'- TCCTTTCTGTCCACAGTGGG -3'

Sequencing Primer
(F):5'- CTATACAGCAGACTATCATTTTGACC -3'
(R):5'- AGTACAATTGCCCAGGCTTG -3'
Posted On2017-05-11