Incidental Mutation 'R5400:Neto1'
ID 475516
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Name neuropilin (NRP) and tolloid (TLL)-like 1
Synonyms C130005O10Rik
MMRRC Submission 042971-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5400 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 86413077-86524843 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 86414033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 9 (H9R)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
AlphaFold Q8R4I7
Predicted Effect possibly damaging
Transcript: ENSMUST00000058829
AA Change: H9R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: H9R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accsl T C 2: 93,689,767 (GRCm39) D380G probably damaging Het
Afm T C 5: 90,699,257 (GRCm39) L567P possibly damaging Het
Anks1b A T 10: 90,348,686 (GRCm39) I785L probably damaging Het
Arpc5l G A 2: 38,903,747 (GRCm39) G79S probably benign Het
Arvcf G T 16: 18,217,820 (GRCm39) R440L probably benign Het
Atm T C 9: 53,414,318 (GRCm39) D924G probably damaging Het
Atp8b1 A T 18: 64,679,060 (GRCm39) probably null Het
Cd19 C T 7: 126,013,624 (GRCm39) G55D probably benign Het
Cd34 A G 1: 194,621,266 (GRCm39) probably benign Het
Cd69 T A 6: 129,246,954 (GRCm39) M88L probably benign Het
Ces2h A G 8: 105,745,057 (GRCm39) E397G probably benign Het
Ddx60 T C 8: 62,463,036 (GRCm39) F1306L possibly damaging Het
Dennd5b T C 6: 148,901,514 (GRCm39) E1124G probably damaging Het
Dio1 A T 4: 107,164,185 (GRCm39) M44K probably damaging Het
Elapor2 A T 5: 9,529,247 (GRCm39) N1027Y probably damaging Het
En1 A G 1: 120,531,324 (GRCm39) D188G probably damaging Het
Epha10 C T 4: 124,807,914 (GRCm39) probably benign Het
Fam120b A T 17: 15,623,388 (GRCm39) L455F possibly damaging Het
Flt4 AC ACC 11: 49,541,861 (GRCm39) probably null Het
Incenp A G 19: 9,855,039 (GRCm39) probably null Het
Kansl3 A G 1: 36,397,230 (GRCm39) V86A possibly damaging Het
Klhl7 C G 5: 24,331,918 (GRCm39) F73L probably damaging Het
Med28 T A 5: 45,682,541 (GRCm39) V69D probably damaging Het
Mknk1 C A 4: 115,721,749 (GRCm39) L98M probably damaging Het
Mknk1 T A 4: 115,721,750 (GRCm39) L98Q probably damaging Het
Myo3b T A 2: 69,935,724 (GRCm39) C97S probably damaging Het
Omd A T 13: 49,745,703 (GRCm39) E371V probably benign Het
Or1n2 A T 2: 36,797,833 (GRCm39) I292F probably damaging Het
Or2w3b T C 11: 58,623,146 (GRCm39) T282A possibly damaging Het
Or4c123 T C 2: 89,127,257 (GRCm39) D119G probably damaging Het
Or51e2 G A 7: 102,391,637 (GRCm39) T191I probably benign Het
Osbpl9 G T 4: 108,919,497 (GRCm39) Y733* probably null Het
Pcdh12 A T 18: 38,401,951 (GRCm39) S91R probably damaging Het
Pxk C A 14: 8,136,911 (GRCm38) P144Q probably benign Het
Qser1 A G 2: 104,620,219 (GRCm39) S198P probably damaging Het
Recql T G 6: 142,308,073 (GRCm39) probably benign Het
Reln T C 5: 22,184,712 (GRCm39) D1601G probably damaging Het
Scn10a T C 9: 119,438,100 (GRCm39) D1922G probably damaging Het
Scn11a T A 9: 119,598,974 (GRCm39) R1185S probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Shoc1 A G 4: 59,082,432 (GRCm39) S399P possibly damaging Het
Slc13a4 A T 6: 35,278,777 (GRCm39) C37* probably null Het
Slc22a30 G A 19: 8,321,757 (GRCm39) Q436* probably null Het
Slc9a9 T A 9: 94,594,954 (GRCm39) F155I probably damaging Het
Spef2 T A 15: 9,614,367 (GRCm39) K1193M probably damaging Het
Swt1 T C 1: 151,288,585 (GRCm39) T80A probably benign Het
Tmc1 A G 19: 20,781,966 (GRCm39) I584T probably damaging Het
Tsc22d1 C A 14: 76,654,494 (GRCm39) F324L probably benign Het
Usp19 T C 9: 108,377,392 (GRCm39) V1236A probably damaging Het
Vmn2r63 T C 7: 42,577,635 (GRCm39) N301S probably benign Het
Wrn C T 8: 33,784,945 (GRCm39) V476I probably benign Het
Zbed6 G A 1: 133,585,879 (GRCm39) T486I probably damaging Het
Zbtb25 C A 12: 76,396,476 (GRCm39) E249* probably null Het
Zfp54 C A 17: 21,653,962 (GRCm39) T152K probably benign Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86,516,937 (GRCm39) missense probably damaging 0.98
IGL01505:Neto1 APN 18 86,491,814 (GRCm39) missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86,414,033 (GRCm39) missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86,491,948 (GRCm39) missense probably damaging 1.00
IGL03072:Neto1 APN 18 86,516,714 (GRCm39) missense probably benign 0.23
R0119:Neto1 UTSW 18 86,479,445 (GRCm39) missense probably benign 0.17
R0136:Neto1 UTSW 18 86,479,445 (GRCm39) missense probably benign 0.17
R0299:Neto1 UTSW 18 86,479,445 (GRCm39) missense probably benign 0.17
R0603:Neto1 UTSW 18 86,491,785 (GRCm39) missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86,422,854 (GRCm39) nonsense probably null
R0657:Neto1 UTSW 18 86,479,445 (GRCm39) missense probably benign 0.17
R1395:Neto1 UTSW 18 86,416,144 (GRCm39) splice site probably benign
R1648:Neto1 UTSW 18 86,518,179 (GRCm39) missense probably damaging 1.00
R1852:Neto1 UTSW 18 86,414,009 (GRCm39) start codon destroyed probably null 0.53
R2249:Neto1 UTSW 18 86,479,399 (GRCm39) missense probably benign 0.02
R4418:Neto1 UTSW 18 86,422,981 (GRCm39) missense probably benign
R4476:Neto1 UTSW 18 86,422,798 (GRCm39) missense probably damaging 0.98
R4676:Neto1 UTSW 18 86,416,427 (GRCm39) missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86,416,406 (GRCm39) missense probably benign
R5282:Neto1 UTSW 18 86,422,998 (GRCm39) missense probably damaging 1.00
R5337:Neto1 UTSW 18 86,416,434 (GRCm39) missense probably benign 0.00
R5435:Neto1 UTSW 18 86,416,388 (GRCm39) missense probably benign 0.00
R5632:Neto1 UTSW 18 86,516,768 (GRCm39) missense probably benign 0.00
R5755:Neto1 UTSW 18 86,517,219 (GRCm39) missense probably damaging 0.99
R6272:Neto1 UTSW 18 86,512,940 (GRCm39) missense probably damaging 1.00
R6486:Neto1 UTSW 18 86,479,371 (GRCm39) missense probably benign
R6505:Neto1 UTSW 18 86,516,699 (GRCm39) missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86,516,873 (GRCm39) missense possibly damaging 0.47
R6582:Neto1 UTSW 18 86,512,985 (GRCm39) nonsense probably null
R6887:Neto1 UTSW 18 86,516,760 (GRCm39) missense probably benign 0.16
R7452:Neto1 UTSW 18 86,517,056 (GRCm39) missense probably benign
R7469:Neto1 UTSW 18 86,516,813 (GRCm39) missense probably benign
R7795:Neto1 UTSW 18 86,479,198 (GRCm39) missense probably benign 0.00
R8912:Neto1 UTSW 18 86,479,173 (GRCm39) missense probably damaging 0.98
R9191:Neto1 UTSW 18 86,516,781 (GRCm39) missense probably damaging 1.00
R9196:Neto1 UTSW 18 86,413,965 (GRCm39) start gained probably benign
R9384:Neto1 UTSW 18 86,413,965 (GRCm39) start gained probably benign
R9597:Neto1 UTSW 18 86,422,821 (GRCm39) missense possibly damaging 0.95
R9674:Neto1 UTSW 18 86,491,827 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAAGACAAACCAGTTCCGATG -3'
(R):5'- TGACCAACTCTGAGGTCCAG -3'

Sequencing Primer
(F):5'- GACAAACCAGTTCCGATGCTTTC -3'
(R):5'- TCCAGCGCCACTCTGTG -3'
Posted On 2017-05-11