Incidental Mutation 'R5400:Neto1'
ID475516
Institutional Source Beutler Lab
Gene Symbol Neto1
Ensembl Gene ENSMUSG00000050321
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 1
SynonymsC130005O10Rik
MMRRC Submission 042971-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5400 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location86394952-86501897 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86395908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 9 (H9R)
Ref Sequence ENSEMBL: ENSMUSP00000057340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058829
AA Change: H9R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057340
Gene: ENSMUSG00000050321
AA Change: H9R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CUB 41 155 2.06e-35 SMART
CUB 172 287 3.1e-7 SMART
LDLa 291 328 3.11e-3 SMART
transmembrane domain 341 363 N/A INTRINSIC
low complexity region 485 497 N/A INTRINSIC
Meta Mutation Damage Score 0.0575 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in mice encodes a protein that plays a critical role in spatial learning and memory by regulating the function of synaptic N-methyl-D-aspartic acid receptor complexes in the hippocampus. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit depressed long term potentiation, reduced NMDAR excitatory postsynaptic potentiation, and decreased spartial learning and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,479,247 N1027Y probably damaging Het
Accsl T C 2: 93,859,422 D380G probably damaging Het
Afm T C 5: 90,551,398 L567P possibly damaging Het
AI481877 A G 4: 59,082,432 S399P possibly damaging Het
Anks1b A T 10: 90,512,824 I785L probably damaging Het
Arpc5l G A 2: 39,013,735 G79S probably benign Het
Arvcf G T 16: 18,399,070 R440L probably benign Het
Atm T C 9: 53,503,018 D924G probably damaging Het
Atp8b1 A T 18: 64,545,989 probably null Het
Cd19 C T 7: 126,414,452 G55D probably benign Het
Cd34 A G 1: 194,938,958 probably benign Het
Cd69 T A 6: 129,269,991 M88L probably benign Het
Ces2h A G 8: 105,018,425 E397G probably benign Het
Ddx60 T C 8: 62,010,002 F1306L possibly damaging Het
Dennd5b T C 6: 149,000,016 E1124G probably damaging Het
Dio1 A T 4: 107,306,988 M44K probably damaging Het
En1 A G 1: 120,603,595 D188G probably damaging Het
Epha10 C T 4: 124,914,121 probably benign Het
Fam120b A T 17: 15,403,126 L455F possibly damaging Het
Flt4 AC ACC 11: 49,651,034 probably null Het
Gm38394 G A 1: 133,658,141 T486I probably damaging Het
Incenp A G 19: 9,877,675 probably null Het
Kansl3 A G 1: 36,358,149 V86A possibly damaging Het
Klhl7 C G 5: 24,126,920 F73L probably damaging Het
Med28 T A 5: 45,525,199 V69D probably damaging Het
Mknk1 C A 4: 115,864,552 L98M probably damaging Het
Mknk1 T A 4: 115,864,553 L98Q probably damaging Het
Myo3b T A 2: 70,105,380 C97S probably damaging Het
Olfr1230 T C 2: 89,296,913 D119G probably damaging Het
Olfr317 T C 11: 58,732,320 T282A possibly damaging Het
Olfr354 A T 2: 36,907,821 I292F probably damaging Het
Olfr78 G A 7: 102,742,430 T191I probably benign Het
Omd A T 13: 49,592,227 E371V probably benign Het
Osbpl9 G T 4: 109,062,300 Y733* probably null Het
Pcdh12 A T 18: 38,268,898 S91R probably damaging Het
Pxk C A 14: 8,136,911 P144Q probably benign Het
Qser1 A G 2: 104,789,874 S198P probably damaging Het
Recql T G 6: 142,362,347 probably benign Het
Reln T C 5: 21,979,714 D1601G probably damaging Het
Scn10a T C 9: 119,609,034 D1922G probably damaging Het
Scn11a T A 9: 119,769,908 R1185S probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc13a4 A T 6: 35,301,842 C37* probably null Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc9a9 T A 9: 94,712,901 F155I probably damaging Het
Spef2 T A 15: 9,614,281 K1193M probably damaging Het
Swt1 T C 1: 151,412,834 T80A probably benign Het
Tmc1 A G 19: 20,804,602 I584T probably damaging Het
Tsc22d1 C A 14: 76,417,054 F324L probably benign Het
Usp19 T C 9: 108,500,193 V1236A probably damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wrn C T 8: 33,294,917 V476I probably benign Het
Zbtb25 C A 12: 76,349,702 E249* probably null Het
Zfp54 C A 17: 21,433,700 T152K probably benign Het
Other mutations in Neto1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Neto1 APN 18 86498812 missense probably damaging 0.98
IGL01505:Neto1 APN 18 86473689 missense possibly damaging 0.82
IGL01511:Neto1 APN 18 86395908 missense possibly damaging 0.96
IGL02704:Neto1 APN 18 86473823 missense probably damaging 1.00
IGL03072:Neto1 APN 18 86498589 missense probably benign 0.23
R0119:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0136:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0299:Neto1 UTSW 18 86461320 missense probably benign 0.17
R0603:Neto1 UTSW 18 86473660 missense possibly damaging 0.95
R0633:Neto1 UTSW 18 86404729 nonsense probably null
R0657:Neto1 UTSW 18 86461320 missense probably benign 0.17
R1395:Neto1 UTSW 18 86398019 splice site probably benign
R1648:Neto1 UTSW 18 86500054 missense probably damaging 1.00
R1852:Neto1 UTSW 18 86395884 start codon destroyed probably null 0.53
R2249:Neto1 UTSW 18 86461274 missense probably benign 0.02
R4418:Neto1 UTSW 18 86404856 missense probably benign
R4476:Neto1 UTSW 18 86404673 missense probably damaging 0.98
R4676:Neto1 UTSW 18 86398302 missense possibly damaging 0.47
R5095:Neto1 UTSW 18 86398281 missense probably benign
R5282:Neto1 UTSW 18 86404873 missense probably damaging 1.00
R5337:Neto1 UTSW 18 86398309 missense probably benign 0.00
R5435:Neto1 UTSW 18 86398263 missense probably benign 0.00
R5632:Neto1 UTSW 18 86498643 missense probably benign 0.00
R5755:Neto1 UTSW 18 86499094 missense probably damaging 0.99
R6272:Neto1 UTSW 18 86494815 missense probably damaging 1.00
R6486:Neto1 UTSW 18 86461246 missense probably benign
R6505:Neto1 UTSW 18 86498574 missense possibly damaging 0.81
R6526:Neto1 UTSW 18 86498748 missense possibly damaging 0.47
R6582:Neto1 UTSW 18 86494860 nonsense probably null
R6887:Neto1 UTSW 18 86498635 missense probably benign 0.16
R7452:Neto1 UTSW 18 86498931 missense probably benign
R7469:Neto1 UTSW 18 86498688 missense probably benign
R7795:Neto1 UTSW 18 86461073 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAAGACAAACCAGTTCCGATG -3'
(R):5'- TGACCAACTCTGAGGTCCAG -3'

Sequencing Primer
(F):5'- GACAAACCAGTTCCGATGCTTTC -3'
(R):5'- TCCAGCGCCACTCTGTG -3'
Posted On2017-05-11