Mutagenetix > Incidental Mutation

Incidental Mutation 'R0506:Slc4a10'

47554

Institutional Source

Beutler Lab

Gene Symbol

Slc4a10

Ensembl Gene

ENSMUSG00000026904

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter-like, member 10

Synonyms

NCBE

MMRRC Submission

038701-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62046462-62326730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62250533 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Asparagine at position 338 (S338N)

Ref Sequence

ENSEMBL: ENSMUSP00000099796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054484] [ENSMUST00000102735] [ENSMUST00000112480]

AlphaFold

Q5DTL9

Predicted Effect

probably benign
Transcript: ENSMUST00000054484
AA Change: S338N

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000061411
Gene: ENSMUSG00000026904
AA Change: S338N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	9e-107	PFAM
Pfam:HCO3_cotransp	445	959	1e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102735
AA Change: S338N

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099796
Gene: ENSMUSG00000026904
AA Change: S338N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	405	2e-106	PFAM
Pfam:HCO3_cotransp	445	959	2.4e-246	PFAM
transmembrane domain	967	989	N/A	INTRINSIC
low complexity region	1011	1025	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112480
AA Change: S368N

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000108099
Gene: ENSMUSG00000026904
AA Change: S368N

Domain	Start	End	E-Value	Type
low complexity region	57	79	N/A	INTRINSIC
low complexity region	106	111	N/A	INTRINSIC
Pfam:Band_3_cyto	146	435	9.6e-108	PFAM
Pfam:HCO3_cotransp	476	989	1.5e-245	PFAM
transmembrane domain	997	1019	N/A	INTRINSIC
low complexity region	1041	1055	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155219

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a small family of sodium-coupled bicarbonate transporters (NCBTs) that regulate the intracellular pH of neurons, the secretion of bicarbonate ions across the choroid plexus, and the pH of the brain extracellular fluid. The protein encoded by this gene was initially identified as a sodium-driven chloride bicarbonate exchanger (NCBE) though there is now evidence that its sodium/bicarbonate cotransport activity is independent of any chloride ion countertransport under physiological conditions. This gene is now classified as a member A10 of the SLC4 family of transmembrane solute carriers. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice with homozygous disruption of this gene exhibit reduced brain ventricle volume, reduced neuronal excitability, impaired pH regulation of neurons, and increased threshold to induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,538,096	C378*	probably null	Het
Ago3	T	C	4: 126,417,252	D56G	possibly damaging	Het
Ahnak	G	T	19: 9,009,128	G2592V	probably damaging	Het
Aldh6a1	C	T	12: 84,433,526	G470D	probably damaging	Het
Ankub1	T	A	3: 57,690,375	N58I	probably damaging	Het
Apol7b	G	T	15: 77,425,528	T23K	probably benign	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Arhgap24	T	C	5: 102,875,777	Y136H	probably damaging	Het
Atp1a1	A	G	3: 101,589,812	F393L	probably damaging	Het
Bcdin3d	A	T	15: 99,470,992	C109S	probably damaging	Het
Catsperd	A	G	17: 56,658,078	K475R	possibly damaging	Het
Cblb	A	G	16: 52,204,480	T913A	probably benign	Het
Cbx6	A	G	15: 79,828,203	L341P	probably benign	Het
Cd177	T	C	7: 24,758,356	Y159C	probably damaging	Het
Cdh7	A	G	1: 110,100,114	N530D	probably damaging	Het
Cdk8	T	C	5: 146,298,872	F270L	probably damaging	Het
Ces2c	A	T	8: 104,848,024	T38S	probably damaging	Het
Chst14	T	C	2: 118,927,721	L357P	probably damaging	Het
Clca3b	T	A	3: 144,822,866		probably benign	Het
Cluh	A	G	11: 74,664,894	S839G	probably benign	Het
Cnga4	T	A	7: 105,407,740	V350E	probably damaging	Het
Creb1	G	A	1: 64,570,267	G180R	probably damaging	Het
Csmd3	T	C	15: 48,457,511	E301G	probably benign	Het
Cyp4f18	A	T	8: 71,996,000	D268E	probably benign	Het
Dock5	A	G	14: 67,784,792		probably benign	Het
Dpy19l4	T	A	4: 11,289,715	H332L	probably benign	Het
Dync2h1	T	A	9: 7,113,153	H224L	probably benign	Het
Dzip1l	C	A	9: 99,663,081	Q585K	possibly damaging	Het
Erf	C	T	7: 25,244,376	G510D	probably damaging	Het
Fanci	T	C	7: 79,432,178	L623P	probably benign	Het
Fat1	T	C	8: 45,022,951	V1655A	probably damaging	Het
Fat4	T	C	3: 38,888,314	V452A	probably benign	Het
Gal3st4	C	T	5: 138,265,889	G283S	probably benign	Het
Gm5422	A	G	10: 31,250,322		noncoding transcript	Het
Gnal	C	T	18: 67,088,673	T49I	unknown	Het
Gng5	A	G	3: 146,503,348	N57S	probably damaging	Het
Herc1	A	G	9: 66,448,159	I2231V	probably damaging	Het
Hgfac	G	T	5: 35,044,240	G272W	probably damaging	Het
Hmcn1	T	A	1: 150,742,341	D1265V	possibly damaging	Het
Ifi207	T	A	1: 173,736,312	Q47L	possibly damaging	Het
Klhl40	G	A	9: 121,778,067	E98K	probably damaging	Het
Lepr	G	T	4: 101,773,010		probably benign	Het
Lyst	A	G	13: 13,638,015	H1004R	probably benign	Het
Map3k1	T	A	13: 111,755,764	R986*	probably null	Het
Mmp1b	C	A	9: 7,387,013	Q66H	possibly damaging	Het
Mpo	T	C	11: 87,803,504	S107P	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Myo7b	A	G	18: 31,964,386		probably null	Het
Myom1	T	C	17: 71,092,220		probably benign	Het
Nalcn	C	T	14: 123,596,614	V50I	possibly damaging	Het
Negr1	A	G	3: 157,160,748		probably benign	Het
Nlrc5	T	G	8: 94,493,125		probably benign	Het
Nyap2	G	A	1: 81,087,312	D14N	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1490	T	A	19: 13,654,897	I151N	possibly damaging	Het
Olfr91	C	A	17: 37,093,311	G188W	probably damaging	Het
Parp14	A	T	16: 35,841,409	S1419T	possibly damaging	Het
Piezo2	A	G	18: 63,027,544	F2347S	probably damaging	Het
Pigf	A	G	17: 87,008,909	V147A	probably benign	Het
Pkhd1	A	T	1: 20,559,469	M637K	probably benign	Het
Plce1	T	C	19: 38,760,138	I1771T	probably benign	Het
Ppp6c	A	T	2: 39,206,648		probably benign	Het
Prag1	T	C	8: 36,103,700	V479A	possibly damaging	Het
Prss33	A	T	17: 23,835,105	D42E	probably benign	Het
Psmb10	A	G	8: 105,937,545	V64A	possibly damaging	Het
Psmd14	A	G	2: 61,800,063	T306A	probably benign	Het
Psmg1	C	T	16: 95,989,487		probably benign	Het
Rc3h2	A	T	2: 37,376,659		probably null	Het
Reln	C	T	5: 21,920,496	V2730I	probably damaging	Het
Sec24a	A	T	11: 51,743,795	H101Q	probably benign	Het
Selenoi	A	G	5: 30,266,956	N385S	probably benign	Het
Slc24a4	T	C	12: 102,131,623		probably null	Het
Slfn3	A	T	11: 83,213,160	T286S	probably damaging	Het
Snx29	A	G	16: 11,395,303	D111G	probably benign	Het
Sp8	T	C	12: 118,848,565	S52P	possibly damaging	Het
Srek1	G	T	13: 103,760,590	T81K	probably damaging	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tatdn2	C	A	6: 113,702,589	D298E	probably benign	Het
Tmem253	A	T	14: 52,017,206		probably benign	Het
Tmem63a	T	A	1: 180,958,049		probably null	Het
Tmprss11b	T	C	5: 86,661,640	D331G	probably damaging	Het
Tor1aip1	T	A	1: 156,007,674	K143*	probably null	Het
Trappc8	A	T	18: 20,844,188	N841K	possibly damaging	Het
Trio	T	C	15: 27,854,963	Q711R	probably benign	Het
Trmt10b	C	A	4: 45,304,306	T114N	probably damaging	Het
Trpv2	C	A	11: 62,582,906	A129D	probably benign	Het
Ttll4	T	G	1: 74,688,618	D846E	probably benign	Het
Ugt2a3	A	G	5: 87,336,649	L172P	possibly damaging	Het
Usp19	T	A	9: 108,494,487	F355Y	probably damaging	Het
Vmn1r209	C	T	13: 22,805,944	G192D	probably damaging	Het
Vmn2r107	T	G	17: 20,357,759	D443E	probably benign	Het
Wee2	A	T	6: 40,463,253	E445V	probably benign	Het
Zer1	A	T	2: 30,101,807	I680N	probably damaging	Het
Zfhx4	T	C	3: 5,402,735	L2651P	probably damaging	Het
Zfp692	C	T	11: 58,309,055	Q157*	probably null	Het
Zfp964	T	A	8: 69,663,937	C396S	unknown	Het

Other mutations in Slc4a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00676:Slc4a10	APN	2	62290001	missense	probably damaging	1.00
IGL00990:Slc4a10	APN	2	62286940	missense	probably damaging	1.00
IGL01294:Slc4a10	APN	2	62253309	critical splice acceptor site	probably null
IGL01628:Slc4a10	APN	2	62268666	missense	probably damaging	1.00
IGL01773:Slc4a10	APN	2	62190757	missense	probably damaging	0.97
IGL02119:Slc4a10	APN	2	62228670	missense	probably damaging	1.00
IGL02125:Slc4a10	APN	2	62268171	missense	probably benign	0.02
IGL02406:Slc4a10	APN	2	62190769	missense	probably benign	0.37
IGL02890:Slc4a10	APN	2	62286916	missense	probably damaging	1.00
IGL02959:Slc4a10	APN	2	62268143	missense	probably damaging	1.00
IGL02979:Slc4a10	APN	2	62288747	missense	probably null	1.00
IGL03144:Slc4a10	APN	2	62250466	missense	probably benign	0.00
IGL03175:Slc4a10	APN	2	62296960	missense	probably damaging	0.99
IGL03383:Slc4a10	APN	2	62267436	missense	probably damaging	1.00
IGL03412:Slc4a10	APN	2	62250543	splice site	probably benign
R0085:Slc4a10	UTSW	2	62244346	splice site	probably benign
R0401:Slc4a10	UTSW	2	62190848	missense	probably benign	0.27
R0433:Slc4a10	UTSW	2	62289983	missense	probably benign	0.01
R0482:Slc4a10	UTSW	2	62297017	splice site	probably benign
R0511:Slc4a10	UTSW	2	62286862	missense	probably damaging	0.97
R0590:Slc4a10	UTSW	2	62190893	splice site	probably benign
R0883:Slc4a10	UTSW	2	62243398	missense	probably benign	0.11
R1167:Slc4a10	UTSW	2	62228574	missense	probably damaging	1.00
R1276:Slc4a10	UTSW	2	62250443	missense	probably damaging	0.99
R1395:Slc4a10	UTSW	2	62313286	missense	probably benign	0.00
R1455:Slc4a10	UTSW	2	62286930	missense	probably damaging	1.00
R1589:Slc4a10	UTSW	2	62257462	missense	probably damaging	1.00
R1677:Slc4a10	UTSW	2	62324727	missense	probably benign
R1848:Slc4a10	UTSW	2	62316606	missense	probably damaging	1.00
R1987:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R1988:Slc4a10	UTSW	2	62268204	missense	probably damaging	1.00
R2018:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2019:Slc4a10	UTSW	2	62234381	missense	probably damaging	1.00
R2407:Slc4a10	UTSW	2	62313343	missense	probably benign
R4067:Slc4a10	UTSW	2	62046645	start codon destroyed	probably benign	0.00
R4184:Slc4a10	UTSW	2	62317442	intron	probably benign
R4255:Slc4a10	UTSW	2	62281936	missense	probably benign	0.10
R4282:Slc4a10	UTSW	2	62244343	splice site	probably null
R4296:Slc4a10	UTSW	2	62234428	missense	possibly damaging	0.80
R4361:Slc4a10	UTSW	2	62243385	missense	probably benign	0.00
R4596:Slc4a10	UTSW	2	62296858	missense	probably damaging	1.00
R4709:Slc4a10	UTSW	2	62257517	missense	probably null	1.00
R4755:Slc4a10	UTSW	2	62296988	missense	probably damaging	1.00
R4836:Slc4a10	UTSW	2	62268187	missense	probably damaging	1.00
R4841:Slc4a10	UTSW	2	62257595	missense	possibly damaging	0.68
R4998:Slc4a10	UTSW	2	62244439	missense	probably benign	0.00
R5069:Slc4a10	UTSW	2	62267571	missense	probably benign	0.06
R5223:Slc4a10	UTSW	2	62253366	missense	probably damaging	1.00
R5244:Slc4a10	UTSW	2	62288725	missense	probably damaging	1.00
R5386:Slc4a10	UTSW	2	62290058	missense	probably damaging	1.00
R5808:Slc4a10	UTSW	2	62250472	missense	probably damaging	1.00
R5999:Slc4a10	UTSW	2	62243431	missense	probably benign	0.10
R6007:Slc4a10	UTSW	2	62268872	missense	probably benign	0.44
R6009:Slc4a10	UTSW	2	62046690	missense	probably benign	0.00
R6015:Slc4a10	UTSW	2	62228702	missense	probably benign	0.05
R6103:Slc4a10	UTSW	2	62234465	missense	probably damaging	1.00
R6141:Slc4a10	UTSW	2	62211445	missense	probably damaging	1.00
R6193:Slc4a10	UTSW	2	62243357	splice site	probably null
R6217:Slc4a10	UTSW	2	62303951	missense	probably benign	0.27
R6280:Slc4a10	UTSW	2	62281966	missense	probably benign	0.05
R6523:Slc4a10	UTSW	2	62286961	nonsense	probably null
R6643:Slc4a10	UTSW	2	62228710	missense	possibly damaging	0.96
R6660:Slc4a10	UTSW	2	62250403	missense	possibly damaging	0.55
R7008:Slc4a10	UTSW	2	62286922	missense	probably benign	0.00
R7083:Slc4a10	UTSW	2	62234495	missense	probably benign	0.03
R7223:Slc4a10	UTSW	2	62268665	missense	probably damaging	0.99
R7243:Slc4a10	UTSW	2	62303862	missense	probably damaging	1.00
R7449:Slc4a10	UTSW	2	62303946	missense	probably benign
R7621:Slc4a10	UTSW	2	62250479	missense	probably damaging	0.98
R7692:Slc4a10	UTSW	2	62303964	missense	possibly damaging	0.94
R7742:Slc4a10	UTSW	2	62296850	missense	probably damaging	1.00
R7905:Slc4a10	UTSW	2	62268151	missense	probably damaging	1.00
R8179:Slc4a10	UTSW	2	62243448	missense	possibly damaging	0.64
R8528:Slc4a10	UTSW	2	62296796	missense	possibly damaging	0.79
R8531:Slc4a10	UTSW	2	62267507	missense	probably damaging	1.00
R8772:Slc4a10	UTSW	2	62303940	missense	probably damaging	1.00
R9307:Slc4a10	UTSW	2	62253318	missense	probably damaging	1.00
R9531:Slc4a10	UTSW	2	62268810	missense	probably damaging	1.00
R9732:Slc4a10	UTSW	2	62304742	missense	probably damaging	0.97
U24488:Slc4a10	UTSW	2	62046658	missense	probably benign	0.05
X0019:Slc4a10	UTSW	2	62228599	missense	probably damaging	1.00
Z1088:Slc4a10	UTSW	2	62228571	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62211379	missense	probably damaging	1.00
Z1176:Slc4a10	UTSW	2	62244416	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAGACATCACCCTTTAGTCTCAGCA -3'
(R):5'- AAGCCAAGCCCTAGAGACCATGA -3'

Sequencing Primer
(F):5'- ACTGAGGAATTTATCAGGCCAAG -3'
(R):5'- AGAGACCATGATCTTCTTGGC -3'

Posted On

2013-06-12