Mutagenetix > Incidental Mutation

Incidental Mutation 'R0506:Zfhx4'

47556

Institutional Source

Beutler Lab

Gene Symbol

Zfhx4

Ensembl Gene

ENSMUSG00000025255

Gene Name

zinc finger homeodomain 4

Synonyms

Zfh4, C130041O22Rik, Zfh-4

MMRRC Submission

038701-MU

Accession Numbers

Genbank: NM_030708; MGI: 2137668

Essential gene?

Probably essential (E-score: 0.788) question?

Stock #

R0506 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

5218526-5415857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5402735 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 2651 (L2651P)

Ref Sequence

ENSEMBL: ENSMUSP00000135289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026284
AA Change: L2651P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: L2651P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175866
AA Change: L2676P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: L2676P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	902	923	2.44e2	SMART
ZnF_U1	938	972	2.88e0	SMART
ZnF_C2H2	941	965	1.23e0	SMART
ZnF_C2H2	997	1019	7.05e-1	SMART
ZnF_U1	1042	1076	3.73e0	SMART
ZnF_C2H2	1045	1069	4.98e-1	SMART
ZnF_C2H2	1213	1236	1.1e-2	SMART
ZnF_C2H2	1242	1265	4.94e0	SMART
ZnF_C2H2	1393	1415	7.67e-2	SMART
ZnF_C2H2	1421	1444	1.33e-1	SMART
ZnF_U1	1534	1568	7.4e-1	SMART
ZnF_C2H2	1537	1561	8.22e-2	SMART
ZnF_U1	1586	1620	3.73e0	SMART
ZnF_C2H2	1589	1613	1.16e-1	SMART
low complexity region	1689	1717	N/A	INTRINSIC
low complexity region	1726	1738	N/A	INTRINSIC
low complexity region	1787	1833	N/A	INTRINSIC
ZnF_C2H2	1941	1964	3.07e-1	SMART
low complexity region	1989	2015	N/A	INTRINSIC
low complexity region	2033	2057	N/A	INTRINSIC
low complexity region	2080	2097	N/A	INTRINSIC
HOX	2125	2187	4.23e-16	SMART
HOX	2222	2284	5.62e-21	SMART
ZnF_C2H2	2308	2328	1.13e1	SMART
low complexity region	2389	2401	N/A	INTRINSIC
low complexity region	2433	2450	N/A	INTRINSIC
low complexity region	2474	2485	N/A	INTRINSIC
ZnF_C2H2	2486	2508	2.17e-1	SMART
HOX	2598	2660	3.18e-20	SMART
ZnF_C2H2	2668	2691	6.67e-2	SMART
low complexity region	2899	2911	N/A	INTRINSIC
HOX	2921	2983	4.54e-16	SMART
ZnF_U1	2996	3030	6.59e-1	SMART
ZnF_C2H2	2999	3023	1.36e1	SMART
low complexity region	3091	3103	N/A	INTRINSIC
low complexity region	3131	3144	N/A	INTRINSIC
low complexity region	3188	3211	N/A	INTRINSIC
coiled coil region	3304	3333	N/A	INTRINSIC
ZnF_C2H2	3393	3413	1.12e2	SMART
ZnF_U1	3434	3468	6.16e-2	SMART
ZnF_C2H2	3437	3461	6.57e0	SMART
low complexity region	3486	3504	N/A	INTRINSIC
low complexity region	3530	3552	N/A	INTRINSIC
low complexity region	3561	3572	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176383
AA Change: L2651P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: L2651P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Meta Mutation Damage Score

0.3466

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (100/100)

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,538,096	C378*	probably null	Het
Ago3	T	C	4: 126,417,252	D56G	possibly damaging	Het
Ahnak	G	T	19: 9,009,128	G2592V	probably damaging	Het
Aldh6a1	C	T	12: 84,433,526	G470D	probably damaging	Het
Ankub1	T	A	3: 57,690,375	N58I	probably damaging	Het
Apol7b	G	T	15: 77,425,528	T23K	probably benign	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Arhgap24	T	C	5: 102,875,777	Y136H	probably damaging	Het
Atp1a1	A	G	3: 101,589,812	F393L	probably damaging	Het
Bcdin3d	A	T	15: 99,470,992	C109S	probably damaging	Het
Catsperd	A	G	17: 56,658,078	K475R	possibly damaging	Het
Cblb	A	G	16: 52,204,480	T913A	probably benign	Het
Cbx6	A	G	15: 79,828,203	L341P	probably benign	Het
Cd177	T	C	7: 24,758,356	Y159C	probably damaging	Het
Cdh7	A	G	1: 110,100,114	N530D	probably damaging	Het
Cdk8	T	C	5: 146,298,872	F270L	probably damaging	Het
Ces2c	A	T	8: 104,848,024	T38S	probably damaging	Het
Chst14	T	C	2: 118,927,721	L357P	probably damaging	Het
Clca3b	T	A	3: 144,822,866		probably benign	Het
Cluh	A	G	11: 74,664,894	S839G	probably benign	Het
Cnga4	T	A	7: 105,407,740	V350E	probably damaging	Het
Creb1	G	A	1: 64,570,267	G180R	probably damaging	Het
Csmd3	T	C	15: 48,457,511	E301G	probably benign	Het
Cyp4f18	A	T	8: 71,996,000	D268E	probably benign	Het
Dock5	A	G	14: 67,784,792		probably benign	Het
Dpy19l4	T	A	4: 11,289,715	H332L	probably benign	Het
Dync2h1	T	A	9: 7,113,153	H224L	probably benign	Het
Dzip1l	C	A	9: 99,663,081	Q585K	possibly damaging	Het
Erf	C	T	7: 25,244,376	G510D	probably damaging	Het
Fanci	T	C	7: 79,432,178	L623P	probably benign	Het
Fat1	T	C	8: 45,022,951	V1655A	probably damaging	Het
Fat4	T	C	3: 38,888,314	V452A	probably benign	Het
Gal3st4	C	T	5: 138,265,889	G283S	probably benign	Het
Gm5422	A	G	10: 31,250,322		noncoding transcript	Het
Gnal	C	T	18: 67,088,673	T49I	unknown	Het
Gng5	A	G	3: 146,503,348	N57S	probably damaging	Het
Herc1	A	G	9: 66,448,159	I2231V	probably damaging	Het
Hgfac	G	T	5: 35,044,240	G272W	probably damaging	Het
Hmcn1	T	A	1: 150,742,341	D1265V	possibly damaging	Het
Ifi207	T	A	1: 173,736,312	Q47L	possibly damaging	Het
Klhl40	G	A	9: 121,778,067	E98K	probably damaging	Het
Lepr	G	T	4: 101,773,010		probably benign	Het
Lyst	A	G	13: 13,638,015	H1004R	probably benign	Het
Map3k1	T	A	13: 111,755,764	R986*	probably null	Het
Mmp1b	C	A	9: 7,387,013	Q66H	possibly damaging	Het
Mpo	T	C	11: 87,803,504	S107P	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Myo7b	A	G	18: 31,964,386		probably null	Het
Myom1	T	C	17: 71,092,220		probably benign	Het
Nalcn	C	T	14: 123,596,614	V50I	possibly damaging	Het
Negr1	A	G	3: 157,160,748		probably benign	Het
Nlrc5	T	G	8: 94,493,125		probably benign	Het
Nyap2	G	A	1: 81,087,312	D14N	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1490	T	A	19: 13,654,897	I151N	possibly damaging	Het
Olfr91	C	A	17: 37,093,311	G188W	probably damaging	Het
Parp14	A	T	16: 35,841,409	S1419T	possibly damaging	Het
Piezo2	A	G	18: 63,027,544	F2347S	probably damaging	Het
Pigf	A	G	17: 87,008,909	V147A	probably benign	Het
Pkhd1	A	T	1: 20,559,469	M637K	probably benign	Het
Plce1	T	C	19: 38,760,138	I1771T	probably benign	Het
Ppp6c	A	T	2: 39,206,648		probably benign	Het
Prag1	T	C	8: 36,103,700	V479A	possibly damaging	Het
Prss33	A	T	17: 23,835,105	D42E	probably benign	Het
Psmb10	A	G	8: 105,937,545	V64A	possibly damaging	Het
Psmd14	A	G	2: 61,800,063	T306A	probably benign	Het
Psmg1	C	T	16: 95,989,487		probably benign	Het
Rc3h2	A	T	2: 37,376,659		probably null	Het
Reln	C	T	5: 21,920,496	V2730I	probably damaging	Het
Sec24a	A	T	11: 51,743,795	H101Q	probably benign	Het
Selenoi	A	G	5: 30,266,956	N385S	probably benign	Het
Slc24a4	T	C	12: 102,131,623		probably null	Het
Slc4a10	G	A	2: 62,250,533	S338N	probably benign	Het
Slfn3	A	T	11: 83,213,160	T286S	probably damaging	Het
Snx29	A	G	16: 11,395,303	D111G	probably benign	Het
Sp8	T	C	12: 118,848,565	S52P	possibly damaging	Het
Srek1	G	T	13: 103,760,590	T81K	probably damaging	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tatdn2	C	A	6: 113,702,589	D298E	probably benign	Het
Tmem253	A	T	14: 52,017,206		probably benign	Het
Tmem63a	T	A	1: 180,958,049		probably null	Het
Tmprss11b	T	C	5: 86,661,640	D331G	probably damaging	Het
Tor1aip1	T	A	1: 156,007,674	K143*	probably null	Het
Trappc8	A	T	18: 20,844,188	N841K	possibly damaging	Het
Trio	T	C	15: 27,854,963	Q711R	probably benign	Het
Trmt10b	C	A	4: 45,304,306	T114N	probably damaging	Het
Trpv2	C	A	11: 62,582,906	A129D	probably benign	Het
Ttll4	T	G	1: 74,688,618	D846E	probably benign	Het
Ugt2a3	A	G	5: 87,336,649	L172P	possibly damaging	Het
Usp19	T	A	9: 108,494,487	F355Y	probably damaging	Het
Vmn1r209	C	T	13: 22,805,944	G192D	probably damaging	Het
Vmn2r107	T	G	17: 20,357,759	D443E	probably benign	Het
Wee2	A	T	6: 40,463,253	E445V	probably benign	Het
Zer1	A	T	2: 30,101,807	I680N	probably damaging	Het
Zfp692	C	T	11: 58,309,055	Q157*	probably null	Het
Zfp964	T	A	8: 69,663,937	C396S	unknown	Het

Other mutations in Zfhx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Zfhx4	APN	3	5242341	missense	probably damaging	1.00
IGL00915:Zfhx4	APN	3	5245523	missense	probably damaging	0.99
IGL01145:Zfhx4	APN	3	5245347	missense	probably damaging	1.00
IGL01302:Zfhx4	APN	3	5243568	missense	probably damaging	1.00
IGL01314:Zfhx4	APN	3	5413094	missense	probably damaging	0.98
IGL01321:Zfhx4	APN	3	5242328	missense	probably benign	0.01
IGL01328:Zfhx4	APN	3	5244284	missense	probably damaging	1.00
IGL01333:Zfhx4	APN	3	5399327	missense	probably damaging	1.00
IGL01351:Zfhx4	APN	3	5401136	missense	probably damaging	1.00
IGL01524:Zfhx4	APN	3	5243976	missense	probably damaging	1.00
IGL01549:Zfhx4	APN	3	5399462	missense	probably damaging	1.00
IGL01715:Zfhx4	APN	3	5242045	missense	probably benign	0.00
IGL01736:Zfhx4	APN	3	5244092	missense	possibly damaging	0.85
IGL01904:Zfhx4	APN	3	5412709	missense	probably damaging	1.00
IGL02298:Zfhx4	APN	3	5244304	splice site	probably null
IGL02342:Zfhx4	APN	3	5402374	missense	probably benign	0.14
IGL02465:Zfhx4	APN	3	5399603	missense	possibly damaging	0.48
IGL02481:Zfhx4	APN	3	5411843	missense	probably damaging	0.99
IGL02511:Zfhx4	APN	3	5399183	missense	probably damaging	1.00
IGL02571:Zfhx4	APN	3	5329523	missense	probably damaging	1.00
IGL02685:Zfhx4	APN	3	5412153	missense	probably damaging	1.00
IGL02721:Zfhx4	APN	3	5243307	missense	possibly damaging	0.76
IGL02806:Zfhx4	APN	3	5390408	missense	probably benign	0.00
IGL03140:Zfhx4	APN	3	5242525	missense	probably damaging	1.00
IGL03185:Zfhx4	APN	3	5403914	missense	probably benign	0.05
IGL03209:Zfhx4	APN	3	5401171	missense	probably damaging	1.00
IGL03292:Zfhx4	APN	3	5411780	nonsense	probably null
IGL03302:Zfhx4	APN	3	5403713	missense	possibly damaging	0.88
IGL03303:Zfhx4	APN	3	5403350	missense	probably damaging	1.00
IGL03341:Zfhx4	APN	3	5411850	missense	probably damaging	0.98
3-1:Zfhx4	UTSW	3	5403385	missense	probably benign	0.14
B5639:Zfhx4	UTSW	3	5403175	missense	probably damaging	0.99
IGL02796:Zfhx4	UTSW	3	5399539	missense	probably damaging	1.00
IGL03047:Zfhx4	UTSW	3	5243733	missense	probably damaging	0.99
P0025:Zfhx4	UTSW	3	5399588	missense	probably benign	0.04
PIT4377001:Zfhx4	UTSW	3	5242742	missense	probably damaging	0.98
R0090:Zfhx4	UTSW	3	5243625	missense	probably damaging	1.00
R0107:Zfhx4	UTSW	3	5398982	missense	probably damaging	1.00
R0401:Zfhx4	UTSW	3	5401161	missense	possibly damaging	0.87
R0465:Zfhx4	UTSW	3	5245656	splice site	probably benign
R0507:Zfhx4	UTSW	3	5400988	nonsense	probably null
R0550:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R0576:Zfhx4	UTSW	3	5402101	missense	probably damaging	1.00
R0590:Zfhx4	UTSW	3	5402633	missense	probably damaging	1.00
R0697:Zfhx4	UTSW	3	5401733	missense	probably damaging	0.99
R0727:Zfhx4	UTSW	3	5401073	missense	probably damaging	0.98
R0762:Zfhx4	UTSW	3	5403820	missense	probably damaging	1.00
R0815:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0863:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0866:Zfhx4	UTSW	3	5412212	missense	possibly damaging	0.58
R1109:Zfhx4	UTSW	3	5399870	missense	possibly damaging	0.59
R1177:Zfhx4	UTSW	3	5400831	small deletion	probably benign
R1338:Zfhx4	UTSW	3	5396961	missense	possibly damaging	0.86
R1388:Zfhx4	UTSW	3	5401387	missense	probably damaging	1.00
R1434:Zfhx4	UTSW	3	5241859	missense	probably benign	0.00
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1552:Zfhx4	UTSW	3	5403110	missense	probably damaging	1.00
R1589:Zfhx4	UTSW	3	5241729	missense	probably damaging	1.00
R1633:Zfhx4	UTSW	3	5400413	missense	probably damaging	1.00
R1656:Zfhx4	UTSW	3	5413016	missense	probably damaging	1.00
R1717:Zfhx4	UTSW	3	5403104	missense	probably benign	0.20
R1739:Zfhx4	UTSW	3	5401730	missense	probably damaging	1.00
R1760:Zfhx4	UTSW	3	5382616	missense	probably benign
R1842:Zfhx4	UTSW	3	5401498	missense	probably damaging	1.00
R1867:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R1868:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R2064:Zfhx4	UTSW	3	5398927	missense	probably damaging	1.00
R2083:Zfhx4	UTSW	3	5403163	missense	possibly damaging	0.58
R2154:Zfhx4	UTSW	3	5401741	missense	possibly damaging	0.86
R2165:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2181:Zfhx4	UTSW	3	5403332	missense	probably damaging	1.00
R2201:Zfhx4	UTSW	3	5242289	missense	probably damaging	1.00
R2209:Zfhx4	UTSW	3	5396918	missense	probably damaging	1.00
R2303:Zfhx4	UTSW	3	5397060	missense	probably damaging	0.99
R2327:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2420:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2422:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2516:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2518:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2519:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2520:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2566:Zfhx4	UTSW	3	5245143	missense	probably damaging	0.98
R2922:Zfhx4	UTSW	3	5403664	missense	probably damaging	1.00
R3000:Zfhx4	UTSW	3	5403654	missense	probably damaging	1.00
R3103:Zfhx4	UTSW	3	5399326	missense	probably damaging	1.00
R3409:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3414:Zfhx4	UTSW	3	5403823	missense	probably damaging	1.00
R3746:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3747:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3748:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3749:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3750:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3763:Zfhx4	UTSW	3	5403344	missense	probably damaging	1.00
R3826:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3827:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3830:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3877:Zfhx4	UTSW	3	5400785	missense	probably benign
R3919:Zfhx4	UTSW	3	5399115	missense	possibly damaging	0.48
R3922:Zfhx4	UTSW	3	5400647	missense	probably damaging	1.00
R3927:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3965:Zfhx4	UTSW	3	5403847	missense	probably damaging	1.00
R4004:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R4049:Zfhx4	UTSW	3	5398859	missense	probably damaging	1.00
R4073:Zfhx4	UTSW	3	5399324	missense	probably damaging	1.00
R4134:Zfhx4	UTSW	3	5243627	missense	probably damaging	1.00
R4401:Zfhx4	UTSW	3	5403345	nonsense	probably null
R4439:Zfhx4	UTSW	3	5214815	unclassified	probably benign
R4497:Zfhx4	UTSW	3	5399620	missense	possibly damaging	0.88
R4518:Zfhx4	UTSW	3	5412518	missense	probably damaging	1.00
R4569:Zfhx4	UTSW	3	5401834	missense	probably benign	0.00
R4612:Zfhx4	UTSW	3	5397063	missense	probably damaging	1.00
R4616:Zfhx4	UTSW	3	5413067	missense	possibly damaging	0.66
R4626:Zfhx4	UTSW	3	5402639	missense	probably damaging	1.00
R4628:Zfhx4	UTSW	3	5403476	missense	probably damaging	1.00
R4637:Zfhx4	UTSW	3	5403404	missense	probably damaging	1.00
R4647:Zfhx4	UTSW	3	5399281	missense	probably damaging	0.99
R4708:Zfhx4	UTSW	3	5245503	splice site	probably null
R4729:Zfhx4	UTSW	3	5399497	missense	probably damaging	1.00
R4732:Zfhx4	UTSW	3	5214807	unclassified	probably benign
R4757:Zfhx4	UTSW	3	5400062	missense	possibly damaging	0.85
R4765:Zfhx4	UTSW	3	5400152	missense	probably benign
R4819:Zfhx4	UTSW	3	5403914	missense	probably benign	0.05
R4937:Zfhx4	UTSW	3	5242011	missense	probably damaging	1.00
R4980:Zfhx4	UTSW	3	5398979	missense	possibly damaging	0.47
R5124:Zfhx4	UTSW	3	5242047	missense	probably damaging	1.00
R5214:Zfhx4	UTSW	3	5403641	missense	probably damaging	1.00
R5361:Zfhx4	UTSW	3	5399207	missense	probably damaging	0.99
R5375:Zfhx4	UTSW	3	5412425	missense	probably damaging	0.99
R5485:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00
R5588:Zfhx4	UTSW	3	5403138	missense	probably damaging	1.00
R5609:Zfhx4	UTSW	3	5403619	missense	probably damaging	1.00
R5726:Zfhx4	UTSW	3	5403321	missense	probably benign	0.02
R5758:Zfhx4	UTSW	3	5402620	missense	probably damaging	1.00
R5865:Zfhx4	UTSW	3	5402659	missense	probably damaging	1.00
R5938:Zfhx4	UTSW	3	5402138	missense	probably damaging	0.99
R5952:Zfhx4	UTSW	3	5396970	missense	probably damaging	0.99
R6043:Zfhx4	UTSW	3	5403427	missense	probably benign	0.00
R6045:Zfhx4	UTSW	3	5396959	missense	probably damaging	1.00
R6125:Zfhx4	UTSW	3	5398811	missense	possibly damaging	0.68
R6354:Zfhx4	UTSW	3	5401951	missense	probably benign
R6374:Zfhx4	UTSW	3	5244035	missense	probably damaging	1.00
R6378:Zfhx4	UTSW	3	5243350	missense	probably benign	0.07
R6380:Zfhx4	UTSW	3	5413110	missense	probably damaging	0.99
R6413:Zfhx4	UTSW	3	5243145	missense	probably damaging	1.00
R6449:Zfhx4	UTSW	3	5242428	missense	probably damaging	1.00
R6539:Zfhx4	UTSW	3	5244108	missense	probably damaging	0.99
R6714:Zfhx4	UTSW	3	5241837	missense	probably damaging	1.00
R6933:Zfhx4	UTSW	3	5412987	missense	probably damaging	0.99
R6982:Zfhx4	UTSW	3	5403830	missense	probably damaging	1.00
R7104:Zfhx4	UTSW	3	5402489	missense	probably damaging	0.97
R7127:Zfhx4	UTSW	3	5413044	missense	probably damaging	0.99
R7138:Zfhx4	UTSW	3	5412047	missense	possibly damaging	0.69
R7161:Zfhx4	UTSW	3	5244083	missense	possibly damaging	0.65
R7213:Zfhx4	UTSW	3	5396644	missense	probably benign
R7483:Zfhx4	UTSW	3	5412177	missense	probably damaging	0.98
R7514:Zfhx4	UTSW	3	5242207	missense	possibly damaging	0.91
R7544:Zfhx4	UTSW	3	5412815	missense	probably damaging	0.98
R7565:Zfhx4	UTSW	3	5390366	missense	probably benign	0.04
R7611:Zfhx4	UTSW	3	5403771	missense	probably damaging	1.00
R7640:Zfhx4	UTSW	3	5412480	missense	probably benign	0.19
R7649:Zfhx4	UTSW	3	5242110	missense	probably damaging	1.00
R7689:Zfhx4	UTSW	3	5411886	missense	probably benign	0.05
R7711:Zfhx4	UTSW	3	5396956	missense	probably damaging	0.98
R7895:Zfhx4	UTSW	3	5242199	missense	probably benign	0.00
R7920:Zfhx4	UTSW	3	5400455	missense	possibly damaging	0.62
R7972:Zfhx4	UTSW	3	5412473	missense	probably benign	0.02
R7993:Zfhx4	UTSW	3	5412987	missense	probably damaging	1.00
R8133:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R8158:Zfhx4	UTSW	3	5398950	nonsense	probably null
R8272:Zfhx4	UTSW	3	5243867	missense	probably damaging	0.99
R8285:Zfhx4	UTSW	3	5401856	missense	probably benign	0.17
R8321:Zfhx4	UTSW	3	5401127	missense	probably damaging	1.00
R8381:Zfhx4	UTSW	3	5382616	missense	probably benign	0.00
R8434:Zfhx4	UTSW	3	5398858	missense	probably damaging	0.99
R8466:Zfhx4	UTSW	3	5242702	missense	probably damaging	1.00
R8515:Zfhx4	UTSW	3	5399474	missense	probably benign	0.00
R8525:Zfhx4	UTSW	3	5399543	missense	probably damaging	1.00
R8743:Zfhx4	UTSW	3	5244024	missense	probably damaging	1.00
R8830:Zfhx4	UTSW	3	5398889	missense	probably damaging	1.00
R8839:Zfhx4	UTSW	3	5401855	missense	probably benign
R8856:Zfhx4	UTSW	3	5390424	missense	probably benign	0.45
R8900:Zfhx4	UTSW	3	5398864	missense	probably damaging	1.00
R8917:Zfhx4	UTSW	3	5399099	missense	probably damaging	1.00
R9101:Zfhx4	UTSW	3	5412138	missense	probably benign	0.10
R9126:Zfhx4	UTSW	3	5329529	missense	probably damaging	0.99
R9159:Zfhx4	UTSW	3	5399252	missense	probably damaging	0.98
R9159:Zfhx4	UTSW	3	5401157	missense	probably damaging	1.00
R9241:Zfhx4	UTSW	3	5243637	missense	probably damaging	1.00
R9295:Zfhx4	UTSW	3	5329465	missense	probably benign
R9376:Zfhx4	UTSW	3	5241773	missense	probably damaging	1.00
R9376:Zfhx4	UTSW	3	5400335	missense	probably benign	0.04
R9550:Zfhx4	UTSW	3	5399512	missense	probably damaging	1.00
R9680:Zfhx4	UTSW	3	5400596	missense	probably damaging	1.00
R9782:Zfhx4	UTSW	3	5401454	missense	probably benign	0.38
R9787:Zfhx4	UTSW	3	5390446	missense	possibly damaging	0.94
R9790:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
R9791:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
RF019:Zfhx4	UTSW	3	5403267	missense	probably benign	0.08
X0025:Zfhx4	UTSW	3	5411836	missense	probably damaging	0.99
X0026:Zfhx4	UTSW	3	5412338	missense	probably benign	0.00
X0028:Zfhx4	UTSW	3	5402414	missense	probably benign	0.13
X0028:Zfhx4	UTSW	3	5403267	missense	probably damaging	1.00
X0054:Zfhx4	UTSW	3	5399710	nonsense	probably null
Z1177:Zfhx4	UTSW	3	5242446	missense	probably damaging	1.00
Z1187:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACCGTGATAAACGCTTGAGAACC -3'
(R):5'- CGTAGAGACTGTGGAGGCCAATTC -3'

Sequencing Primer
(F):5'- CTGAGCAACTCGAAATACTCTATG -3'
(R):5'- GGAGGCCAATTCATTCTCAGTAG -3'

Posted On

2013-06-12