Mutagenetix > Incidental Mutation

Incidental Mutation 'R0506:Reln'

47567

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

038701-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R0506 (G1)

Quality Score

179

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21920496 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 2730 (V2730I)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: V2730I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V2730I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084713

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159768

Predicted Effect

probably damaging
Transcript: ENSMUST00000161356
AA Change: V2730I

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V2730I

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,538,096	C378*	probably null	Het
Ago3	T	C	4: 126,417,252	D56G	possibly damaging	Het
Ahnak	G	T	19: 9,009,128	G2592V	probably damaging	Het
Aldh6a1	C	T	12: 84,433,526	G470D	probably damaging	Het
Ankub1	T	A	3: 57,690,375	N58I	probably damaging	Het
Apol7b	G	T	15: 77,425,528	T23K	probably benign	Het
Arap2	G	A	5: 62,606,131	P1557S	possibly damaging	Het
Arhgap24	T	C	5: 102,875,777	Y136H	probably damaging	Het
Atp1a1	A	G	3: 101,589,812	F393L	probably damaging	Het
Bcdin3d	A	T	15: 99,470,992	C109S	probably damaging	Het
Catsperd	A	G	17: 56,658,078	K475R	possibly damaging	Het
Cblb	A	G	16: 52,204,480	T913A	probably benign	Het
Cbx6	A	G	15: 79,828,203	L341P	probably benign	Het
Cd177	T	C	7: 24,758,356	Y159C	probably damaging	Het
Cdh7	A	G	1: 110,100,114	N530D	probably damaging	Het
Cdk8	T	C	5: 146,298,872	F270L	probably damaging	Het
Ces2c	A	T	8: 104,848,024	T38S	probably damaging	Het
Chst14	T	C	2: 118,927,721	L357P	probably damaging	Het
Clca3b	T	A	3: 144,822,866		probably benign	Het
Cluh	A	G	11: 74,664,894	S839G	probably benign	Het
Cnga4	T	A	7: 105,407,740	V350E	probably damaging	Het
Creb1	G	A	1: 64,570,267	G180R	probably damaging	Het
Csmd3	T	C	15: 48,457,511	E301G	probably benign	Het
Cyp4f18	A	T	8: 71,996,000	D268E	probably benign	Het
Dock5	A	G	14: 67,784,792		probably benign	Het
Dpy19l4	T	A	4: 11,289,715	H332L	probably benign	Het
Dync2h1	T	A	9: 7,113,153	H224L	probably benign	Het
Dzip1l	C	A	9: 99,663,081	Q585K	possibly damaging	Het
Erf	C	T	7: 25,244,376	G510D	probably damaging	Het
Fanci	T	C	7: 79,432,178	L623P	probably benign	Het
Fat1	T	C	8: 45,022,951	V1655A	probably damaging	Het
Fat4	T	C	3: 38,888,314	V452A	probably benign	Het
Gal3st4	C	T	5: 138,265,889	G283S	probably benign	Het
Gm5422	A	G	10: 31,250,322		noncoding transcript	Het
Gnal	C	T	18: 67,088,673	T49I	unknown	Het
Gng5	A	G	3: 146,503,348	N57S	probably damaging	Het
Herc1	A	G	9: 66,448,159	I2231V	probably damaging	Het
Hgfac	G	T	5: 35,044,240	G272W	probably damaging	Het
Hmcn1	T	A	1: 150,742,341	D1265V	possibly damaging	Het
Ifi207	T	A	1: 173,736,312	Q47L	possibly damaging	Het
Klhl40	G	A	9: 121,778,067	E98K	probably damaging	Het
Lepr	G	T	4: 101,773,010		probably benign	Het
Lyst	A	G	13: 13,638,015	H1004R	probably benign	Het
Map3k1	T	A	13: 111,755,764	R986*	probably null	Het
Mmp1b	C	A	9: 7,387,013	Q66H	possibly damaging	Het
Mpo	T	C	11: 87,803,504	S107P	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Myo7b	A	G	18: 31,964,386		probably null	Het
Myom1	T	C	17: 71,092,220		probably benign	Het
Nalcn	C	T	14: 123,596,614	V50I	possibly damaging	Het
Negr1	A	G	3: 157,160,748		probably benign	Het
Nlrc5	T	G	8: 94,493,125		probably benign	Het
Nyap2	G	A	1: 81,087,312	D14N	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1490	T	A	19: 13,654,897	I151N	possibly damaging	Het
Olfr91	C	A	17: 37,093,311	G188W	probably damaging	Het
Parp14	A	T	16: 35,841,409	S1419T	possibly damaging	Het
Piezo2	A	G	18: 63,027,544	F2347S	probably damaging	Het
Pigf	A	G	17: 87,008,909	V147A	probably benign	Het
Pkhd1	A	T	1: 20,559,469	M637K	probably benign	Het
Plce1	T	C	19: 38,760,138	I1771T	probably benign	Het
Ppp6c	A	T	2: 39,206,648		probably benign	Het
Prag1	T	C	8: 36,103,700	V479A	possibly damaging	Het
Prss33	A	T	17: 23,835,105	D42E	probably benign	Het
Psmb10	A	G	8: 105,937,545	V64A	possibly damaging	Het
Psmd14	A	G	2: 61,800,063	T306A	probably benign	Het
Psmg1	C	T	16: 95,989,487		probably benign	Het
Rc3h2	A	T	2: 37,376,659		probably null	Het
Sec24a	A	T	11: 51,743,795	H101Q	probably benign	Het
Selenoi	A	G	5: 30,266,956	N385S	probably benign	Het
Slc24a4	T	C	12: 102,131,623		probably null	Het
Slc4a10	G	A	2: 62,250,533	S338N	probably benign	Het
Slfn3	A	T	11: 83,213,160	T286S	probably damaging	Het
Snx29	A	G	16: 11,395,303	D111G	probably benign	Het
Sp8	T	C	12: 118,848,565	S52P	possibly damaging	Het
Srek1	G	T	13: 103,760,590	T81K	probably damaging	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tatdn2	C	A	6: 113,702,589	D298E	probably benign	Het
Tmem253	A	T	14: 52,017,206		probably benign	Het
Tmem63a	T	A	1: 180,958,049		probably null	Het
Tmprss11b	T	C	5: 86,661,640	D331G	probably damaging	Het
Tor1aip1	T	A	1: 156,007,674	K143*	probably null	Het
Trappc8	A	T	18: 20,844,188	N841K	possibly damaging	Het
Trio	T	C	15: 27,854,963	Q711R	probably benign	Het
Trmt10b	C	A	4: 45,304,306	T114N	probably damaging	Het
Trpv2	C	A	11: 62,582,906	A129D	probably benign	Het
Ttll4	T	G	1: 74,688,618	D846E	probably benign	Het
Ugt2a3	A	G	5: 87,336,649	L172P	possibly damaging	Het
Usp19	T	A	9: 108,494,487	F355Y	probably damaging	Het
Vmn1r209	C	T	13: 22,805,944	G192D	probably damaging	Het
Vmn2r107	T	G	17: 20,357,759	D443E	probably benign	Het
Wee2	A	T	6: 40,463,253	E445V	probably benign	Het
Zer1	A	T	2: 30,101,807	I680N	probably damaging	Het
Zfhx4	T	C	3: 5,402,735	L2651P	probably damaging	Het
Zfp692	C	T	11: 58,309,055	Q157*	probably null	Het
Zfp964	T	A	8: 69,663,937	C396S	unknown	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7135:Reln	UTSW	5	21976596	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22134692	missense	probably benign	0.00
R7938:Reln	UTSW	5	21950872	missense	probably damaging	0.97
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
R8222:Reln	UTSW	5	21931477	nonsense	probably null
R8266:Reln	UTSW	5	22018087	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22004112	missense	probably damaging	1.00
R8487:Reln	UTSW	5	21899029	missense	probably benign	0.03
R8523:Reln	UTSW	5	22004231	missense	probably damaging	1.00
R8751:Reln	UTSW	5	21942674	missense	probably benign	0.37
R8801:Reln	UTSW	5	21950856	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	21925259	missense	probably damaging	0.98
R8978:Reln	UTSW	5	21885514	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	21899157	missense	probably damaging	0.97
R8995:Reln	UTSW	5	21979579	missense	probably benign	0.00
R9022:Reln	UTSW	5	21976615	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22048038	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22011061	missense	probably damaging	1.00
R9089:Reln	UTSW	5	21925200	missense	probably benign	0.01
R9126:Reln	UTSW	5	21955196	missense	probably damaging	1.00
R9172:Reln	UTSW	5	21950817	critical splice donor site	probably null
R9182:Reln	UTSW	5	21901619	missense	probably benign	0.44
R9196:Reln	UTSW	5	22152473	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22344202	nonsense	probably null
R9241:Reln	UTSW	5	21969069	missense	probably damaging	0.99
R9244:Reln	UTSW	5	21915153	missense	probably damaging	0.99
R9281:Reln	UTSW	5	21948547	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22004211	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	21988707	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22080691	missense	probably benign	0.01
R9309:Reln	UTSW	5	21971868	missense	probably benign	0.37
R9338:Reln	UTSW	5	21997939	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22344204	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	21915107	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22344200	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	21920510	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	21931429	missense	probably benign	0.26
R9745:Reln	UTSW	5	21947527	missense	probably damaging	1.00
R9778:Reln	UTSW	5	21950945	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTATCCTTCTGGTGGCTCTGAC -3'
(R):5'- TGGATAAATGGATGGATGTGTGGATGAC -3'

Sequencing Primer
(F):5'- GGCTCTGACCAGGTCGC -3'
(R):5'- acctgaactacaaagtgagacc -3'

Posted On

2013-06-12