Mutagenetix > Incidental Mutation

Incidental Mutation 'R0506:Arap2'

47570

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

038701-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0506 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 62606131 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1557 (P1557S)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000076623
AA Change: P1557S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: P1557S

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160620

Meta Mutation Damage Score

0.0887

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.7%
20x: 93.3%

Validation Efficiency

100% (100/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 97 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,538,096	C378*	probably null	Het
Ago3	T	C	4: 126,417,252	D56G	possibly damaging	Het
Ahnak	G	T	19: 9,009,128	G2592V	probably damaging	Het
Aldh6a1	C	T	12: 84,433,526	G470D	probably damaging	Het
Ankub1	T	A	3: 57,690,375	N58I	probably damaging	Het
Apol7b	G	T	15: 77,425,528	T23K	probably benign	Het
Arhgap24	T	C	5: 102,875,777	Y136H	probably damaging	Het
Atp1a1	A	G	3: 101,589,812	F393L	probably damaging	Het
Bcdin3d	A	T	15: 99,470,992	C109S	probably damaging	Het
Catsperd	A	G	17: 56,658,078	K475R	possibly damaging	Het
Cblb	A	G	16: 52,204,480	T913A	probably benign	Het
Cbx6	A	G	15: 79,828,203	L341P	probably benign	Het
Cd177	T	C	7: 24,758,356	Y159C	probably damaging	Het
Cdh7	A	G	1: 110,100,114	N530D	probably damaging	Het
Cdk8	T	C	5: 146,298,872	F270L	probably damaging	Het
Ces2c	A	T	8: 104,848,024	T38S	probably damaging	Het
Chst14	T	C	2: 118,927,721	L357P	probably damaging	Het
Clca3b	T	A	3: 144,822,866		probably benign	Het
Cluh	A	G	11: 74,664,894	S839G	probably benign	Het
Cnga4	T	A	7: 105,407,740	V350E	probably damaging	Het
Creb1	G	A	1: 64,570,267	G180R	probably damaging	Het
Csmd3	T	C	15: 48,457,511	E301G	probably benign	Het
Cyp4f18	A	T	8: 71,996,000	D268E	probably benign	Het
Dock5	A	G	14: 67,784,792		probably benign	Het
Dpy19l4	T	A	4: 11,289,715	H332L	probably benign	Het
Dync2h1	T	A	9: 7,113,153	H224L	probably benign	Het
Dzip1l	C	A	9: 99,663,081	Q585K	possibly damaging	Het
Erf	C	T	7: 25,244,376	G510D	probably damaging	Het
Fanci	T	C	7: 79,432,178	L623P	probably benign	Het
Fat1	T	C	8: 45,022,951	V1655A	probably damaging	Het
Fat4	T	C	3: 38,888,314	V452A	probably benign	Het
Gal3st4	C	T	5: 138,265,889	G283S	probably benign	Het
Gm5422	A	G	10: 31,250,322		noncoding transcript	Het
Gnal	C	T	18: 67,088,673	T49I	unknown	Het
Gng5	A	G	3: 146,503,348	N57S	probably damaging	Het
Herc1	A	G	9: 66,448,159	I2231V	probably damaging	Het
Hgfac	G	T	5: 35,044,240	G272W	probably damaging	Het
Hmcn1	T	A	1: 150,742,341	D1265V	possibly damaging	Het
Ifi207	T	A	1: 173,736,312	Q47L	possibly damaging	Het
Klhl40	G	A	9: 121,778,067	E98K	probably damaging	Het
Lepr	G	T	4: 101,773,010		probably benign	Het
Lyst	A	G	13: 13,638,015	H1004R	probably benign	Het
Map3k1	T	A	13: 111,755,764	R986*	probably null	Het
Mmp1b	C	A	9: 7,387,013	Q66H	possibly damaging	Het
Mpo	T	C	11: 87,803,504	S107P	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Myo7b	A	G	18: 31,964,386		probably null	Het
Myom1	T	C	17: 71,092,220		probably benign	Het
Nalcn	C	T	14: 123,596,614	V50I	possibly damaging	Het
Negr1	A	G	3: 157,160,748		probably benign	Het
Nlrc5	T	G	8: 94,493,125		probably benign	Het
Nyap2	G	A	1: 81,087,312	D14N	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1490	T	A	19: 13,654,897	I151N	possibly damaging	Het
Olfr91	C	A	17: 37,093,311	G188W	probably damaging	Het
Parp14	A	T	16: 35,841,409	S1419T	possibly damaging	Het
Piezo2	A	G	18: 63,027,544	F2347S	probably damaging	Het
Pigf	A	G	17: 87,008,909	V147A	probably benign	Het
Pkhd1	A	T	1: 20,559,469	M637K	probably benign	Het
Plce1	T	C	19: 38,760,138	I1771T	probably benign	Het
Ppp6c	A	T	2: 39,206,648		probably benign	Het
Prag1	T	C	8: 36,103,700	V479A	possibly damaging	Het
Prss33	A	T	17: 23,835,105	D42E	probably benign	Het
Psmb10	A	G	8: 105,937,545	V64A	possibly damaging	Het
Psmd14	A	G	2: 61,800,063	T306A	probably benign	Het
Psmg1	C	T	16: 95,989,487		probably benign	Het
Rc3h2	A	T	2: 37,376,659		probably null	Het
Reln	C	T	5: 21,920,496	V2730I	probably damaging	Het
Sec24a	A	T	11: 51,743,795	H101Q	probably benign	Het
Selenoi	A	G	5: 30,266,956	N385S	probably benign	Het
Slc24a4	T	C	12: 102,131,623		probably null	Het
Slc4a10	G	A	2: 62,250,533	S338N	probably benign	Het
Slfn3	A	T	11: 83,213,160	T286S	probably damaging	Het
Snx29	A	G	16: 11,395,303	D111G	probably benign	Het
Sp8	T	C	12: 118,848,565	S52P	possibly damaging	Het
Srek1	G	T	13: 103,760,590	T81K	probably damaging	Het
Sry	C	G	Y: 2,662,864	Q265H	unknown	Het
Taf3	A	G	2: 9,940,993	V600A	probably benign	Het
Tatdn2	C	A	6: 113,702,589	D298E	probably benign	Het
Tmem253	A	T	14: 52,017,206		probably benign	Het
Tmem63a	T	A	1: 180,958,049		probably null	Het
Tmprss11b	T	C	5: 86,661,640	D331G	probably damaging	Het
Tor1aip1	T	A	1: 156,007,674	K143*	probably null	Het
Trappc8	A	T	18: 20,844,188	N841K	possibly damaging	Het
Trio	T	C	15: 27,854,963	Q711R	probably benign	Het
Trmt10b	C	A	4: 45,304,306	T114N	probably damaging	Het
Trpv2	C	A	11: 62,582,906	A129D	probably benign	Het
Ttll4	T	G	1: 74,688,618	D846E	probably benign	Het
Ugt2a3	A	G	5: 87,336,649	L172P	possibly damaging	Het
Usp19	T	A	9: 108,494,487	F355Y	probably damaging	Het
Vmn1r209	C	T	13: 22,805,944	G192D	probably damaging	Het
Vmn2r107	T	G	17: 20,357,759	D443E	probably benign	Het
Wee2	A	T	6: 40,463,253	E445V	probably benign	Het
Zer1	A	T	2: 30,101,807	I680N	probably damaging	Het
Zfhx4	T	C	3: 5,402,735	L2651P	probably damaging	Het
Zfp692	C	T	11: 58,309,055	Q157*	probably null	Het
Zfp964	T	A	8: 69,663,937	C396S	unknown	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0551:Arap2	UTSW	5	62641323	splice site	probably null
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62749094	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5426:Arap2	UTSW	5	62642816	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7452:Arap2	UTSW	5	62676549	missense	probably benign	0.00
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62730705	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62730611	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62621981	splice site	probably null
R8277:Arap2	UTSW	5	62613992	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62604326	nonsense	probably null
R8398:Arap2	UTSW	5	62748909	missense	probably damaging	1.00
R8893:Arap2	UTSW	5	62730694	missense	probably damaging	1.00
R8973:Arap2	UTSW	5	62698325	nonsense	probably null
R9102:Arap2	UTSW	5	62748998	missense	probably benign	0.03
R9121:Arap2	UTSW	5	62748983	missense	possibly damaging	0.84
R9174:Arap2	UTSW	5	62698263	missense	probably damaging	1.00
R9222:Arap2	UTSW	5	62671078	missense	possibly damaging	0.96
R9281:Arap2	UTSW	5	62749505	missense	probably damaging	0.97
R9399:Arap2	UTSW	5	62606112	missense	possibly damaging	0.62
R9450:Arap2	UTSW	5	62698419	missense	probably benign	0.16
R9467:Arap2	UTSW	5	62730557	missense	probably benign	0.00
R9567:Arap2	UTSW	5	62604498	missense	probably benign	0.01
R9577:Arap2	UTSW	5	62611717	missense	probably damaging	1.00
R9626:Arap2	UTSW	5	62749535	missense	probably benign	0.00
R9688:Arap2	UTSW	5	62714766	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GCTAGGCACCAGAAGCCAATGATG -3'
(R):5'- AAGGCTAAGTTTCCAGCTAGTCATGC -3'

Sequencing Primer
(F):5'- GCCAATGATGTAATTAATACACCCAG -3'
(R):5'- AAGTGTTTCACATCCCGGAG -3'

Posted On

2013-06-12