Incidental Mutation 'R0506:Psmb10'
ID47589
Institutional Source Beutler Lab
Gene Symbol Psmb10
Ensembl Gene ENSMUSG00000031897
Gene Nameproteasome (prosome, macropain) subunit, beta type 10
SynonymsMecl-1, Mecl1
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R0506 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105935735-105938444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105937545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 64 (V64A)
Ref Sequence ENSEMBL: ENSMUSP00000034369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034368] [ENSMUST00000034369] [ENSMUST00000038896]
PDB Structure
Mouse 20S immunoproteasome in complex with PR-957 [X-RAY DIFFRACTION]
Mouse 20S immunoproteasome [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034368
SMART Domains Protein: ENSMUSP00000034368
Gene: ENSMUSG00000031896

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 33 257 1.41e-92 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000034369
AA Change: V64A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034369
Gene: ENSMUSG00000031897
AA Change: V64A

DomainStartEndE-ValueType
Pfam:Proteasome 36 217 3.9e-49 PFAM
Pfam:Pr_beta_C 231 267 3.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038896
SMART Domains Protein: ENSMUSP00000038232
Gene: ENSMUSG00000035237

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:LCAT 81 414 1.7e-111 PFAM
low complexity region 425 437 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212938
Meta Mutation Damage Score 0.2286 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. Proteolytic processing is required to generate a mature subunit. Expression of this gene is induced by gamma interferon, and this gene product replaces catalytic subunit 2 (proteasome beta 7 subunit) in the immunoproteasome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice have a reduced number of splenic CD8 T cells with defects in proliferation and an altered T cell receptor repertoire to viral antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Psmb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Psmb10 APN 8 105937711 missense probably damaging 1.00
IGL02421:Psmb10 APN 8 105937492 critical splice donor site probably null
IGL03118:Psmb10 APN 8 105936900 missense probably damaging 1.00
R2420:Psmb10 UTSW 8 105937302 missense probably benign 0.20
R4496:Psmb10 UTSW 8 105936028 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCATCTCAGTGTCCGCAGCTAC -3'
(R):5'- AGGAATGCGTCCTTGGAACACGTC -3'

Sequencing Primer
(F):5'- TGTCCGCAGCTACTCCAG -3'
(R):5'- GTTCCTCATGCACGCAAG -3'
Posted On2013-06-12