Incidental Mutation 'R0506:Sec24a'
ID 47597
Institutional Source Beutler Lab
Gene Symbol Sec24a
Ensembl Gene ENSMUSG00000036391
Gene Name Sec24 related gene family, member A (S. cerevisiae)
Synonyms 9430090N21Rik
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 51692264-51763634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 51743795 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 101 (H101Q)
Ref Sequence ENSEMBL: ENSMUSP00000104720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000064297] [ENSMUST00000109092] [ENSMUST00000109097]
AlphaFold Q3U2P1
Predicted Effect probably benign
Transcript: ENSMUST00000038210
AA Change: H101Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: H101Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 8e-19 PFAM
Pfam:Sec23_trunk 497 735 1.2e-87 PFAM
Pfam:Sec23_BS 740 824 1.1e-23 PFAM
Pfam:Sec23_helical 836 938 5.1e-27 PFAM
Pfam:Gelsolin 960 1035 7.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064297
AA Change: H101Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000068065
Gene: ENSMUSG00000036391
AA Change: H101Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 3.5e-18 PFAM
Pfam:Sec23_trunk 498 589 1.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109092
AA Change: H101Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104720
Gene: ENSMUSG00000036391
AA Change: H101Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 423 461 3.9e-19 PFAM
Pfam:Sec23_trunk 497 588 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109097
AA Change: H101Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: H101Q

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 71 84 N/A INTRINSIC
low complexity region 196 235 N/A INTRINSIC
low complexity region 396 414 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 425 462 2.4e-16 PFAM
Pfam:Sec23_trunk 498 736 7.8e-87 PFAM
Pfam:Sec23_BS 741 825 1.1e-22 PFAM
Pfam:Sec23_helical 838 938 6.9e-28 PFAM
Pfam:Gelsolin 961 1036 9.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154325
Meta Mutation Damage Score 0.0587 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Sec24a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Sec24a APN 11 51736504 nonsense probably null
IGL00973:Sec24a APN 11 51729577 critical splice acceptor site probably null
IGL01364:Sec24a APN 11 51713529 critical splice donor site probably null
IGL01476:Sec24a APN 11 51708956 missense possibly damaging 0.88
IGL01725:Sec24a APN 11 51723578 splice site probably null
IGL02069:Sec24a APN 11 51733934 splice site probably benign
IGL02230:Sec24a APN 11 51709034 missense possibly damaging 0.88
IGL02617:Sec24a APN 11 51712187 critical splice donor site probably null
IGL02655:Sec24a APN 11 51734655 missense probably benign 0.43
IGL02756:Sec24a APN 11 51696733 missense probably benign 0.02
IGL03396:Sec24a APN 11 51708967 missense probably benign 0.17
R0153:Sec24a UTSW 11 51700826 missense probably benign 0.08
R0625:Sec24a UTSW 11 51729454 missense probably damaging 0.98
R1084:Sec24a UTSW 11 51713581 missense probably damaging 1.00
R1166:Sec24a UTSW 11 51733467 missense possibly damaging 0.72
R1376:Sec24a UTSW 11 51700913 splice site probably benign
R1487:Sec24a UTSW 11 51731886 missense possibly damaging 0.92
R1541:Sec24a UTSW 11 51743796 missense probably benign 0.41
R1582:Sec24a UTSW 11 51708967 missense probably benign 0.17
R1643:Sec24a UTSW 11 51704385 missense probably benign 0.03
R1672:Sec24a UTSW 11 51743948 nonsense probably null
R1681:Sec24a UTSW 11 51695189 missense probably damaging 0.98
R1756:Sec24a UTSW 11 51733763 splice site probably benign
R1992:Sec24a UTSW 11 51736363 missense probably benign 0.00
R2159:Sec24a UTSW 11 51712350 missense probably damaging 1.00
R2177:Sec24a UTSW 11 51704401 missense probably benign 0.00
R2188:Sec24a UTSW 11 51723584 missense probably damaging 0.99
R2271:Sec24a UTSW 11 51716450 missense possibly damaging 0.91
R3414:Sec24a UTSW 11 51729458 missense probably damaging 1.00
R4349:Sec24a UTSW 11 51715149 missense probably benign 0.03
R4396:Sec24a UTSW 11 51715164 missense possibly damaging 0.86
R4629:Sec24a UTSW 11 51721813 critical splice donor site probably null
R5061:Sec24a UTSW 11 51713532 splice site probably null
R5577:Sec24a UTSW 11 51734621 missense probably benign 0.06
R5717:Sec24a UTSW 11 51707210 missense probably benign
R5915:Sec24a UTSW 11 51756137 missense probably benign 0.11
R6175:Sec24a UTSW 11 51731891 missense probably damaging 1.00
R6341:Sec24a UTSW 11 51717776 missense probably damaging 0.99
R6461:Sec24a UTSW 11 51713546 missense possibly damaging 0.76
R6610:Sec24a UTSW 11 51696656 missense probably benign
R6632:Sec24a UTSW 11 51713649 nonsense probably null
R6907:Sec24a UTSW 11 51712276 missense probably damaging 1.00
R6969:Sec24a UTSW 11 51700816 missense probably benign 0.35
R7132:Sec24a UTSW 11 51715136 nonsense probably null
R7274:Sec24a UTSW 11 51707255 missense probably damaging 1.00
R7475:Sec24a UTSW 11 51713552 missense probably damaging 1.00
R7699:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7700:Sec24a UTSW 11 51712257 missense probably damaging 1.00
R7935:Sec24a UTSW 11 51721922 missense probably benign 0.25
R8042:Sec24a UTSW 11 51704317 missense probably benign
R8345:Sec24a UTSW 11 51743778 missense probably benign 0.00
R9217:Sec24a UTSW 11 51726504 missense probably benign 0.14
X0025:Sec24a UTSW 11 51729547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTTGAAGTGCAGGGTCTCCAGAAG -3'
(R):5'- AAGGCTATGATTCGCAACCTCCAG -3'

Sequencing Primer
(F):5'- CAGGGTCTCCAGAAGAAACATATTG -3'
(R):5'- ACAGTCGAACTACGGTGGTT -3'
Posted On 2013-06-12