Incidental Mutation 'R0506:Trpv2'
ID 47599
Institutional Source Beutler Lab
Gene Symbol Trpv2
Ensembl Gene ENSMUSG00000018507
Gene Name transient receptor potential cation channel, subfamily V, member 2
Synonyms Vrl1, OTRPC2, VRL-1
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.668) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 62465312-62491131 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 62473732 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 129 (A129D)
Ref Sequence ENSEMBL: ENSMUSP00000099703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018651] [ENSMUST00000102643]
AlphaFold Q9WTR1
Predicted Effect probably benign
Transcript: ENSMUST00000018651
AA Change: A129D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018651
Gene: ENSMUSG00000018507
AA Change: A129D

DomainStartEndE-ValueType
Blast:ANK 70 99 2e-8 BLAST
ANK 111 143 9.33e2 SMART
ANK 158 187 1.83e-3 SMART
ANK 204 233 1.46e2 SMART
Blast:ANK 241 274 1e-10 BLAST
ANK 289 319 3.04e0 SMART
Pfam:Ion_trans 387 652 2.3e-12 PFAM
Blast:PHB 674 726 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000102643
AA Change: A129D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099703
Gene: ENSMUSG00000018507
AA Change: A129D

DomainStartEndE-ValueType
Blast:ANK 70 99 2e-8 BLAST
ANK 111 143 9.33e2 SMART
ANK 158 187 1.83e-3 SMART
ANK 204 233 1.46e2 SMART
Blast:ANK 241 274 1e-10 BLAST
ANK 289 319 3.04e0 SMART
transmembrane domain 388 410 N/A INTRINSIC
Pfam:Ion_trans 434 640 8.9e-10 PFAM
Blast:PHB 674 726 4e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153486
Meta Mutation Damage Score 0.0945 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ion channel that is activated by high temperatures above 52 degrees Celsius. The protein may be involved in transduction of high-temperature heat responses in sensory ganglia. It is thought that in other tissues the channel may be activated by stimuli other than heat. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage migration, binding, and phagocytosis with increased susceptiblity and mortality following bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Trpv2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Trpv2 APN 11 62,483,681 (GRCm39) missense probably damaging 1.00
IGL02223:Trpv2 APN 11 62,472,081 (GRCm39) missense probably benign 0.00
Playtar UTSW 11 62,481,086 (GRCm39) missense probably damaging 1.00
PIT4576001:Trpv2 UTSW 11 62,472,027 (GRCm39) missense probably damaging 1.00
R0008:Trpv2 UTSW 11 62,481,086 (GRCm39) missense probably damaging 1.00
R0357:Trpv2 UTSW 11 62,481,130 (GRCm39) missense probably damaging 1.00
R0586:Trpv2 UTSW 11 62,483,596 (GRCm39) missense probably benign 0.01
R0690:Trpv2 UTSW 11 62,475,502 (GRCm39) critical splice donor site probably null
R1519:Trpv2 UTSW 11 62,480,652 (GRCm39) critical splice donor site probably null
R1556:Trpv2 UTSW 11 62,483,059 (GRCm39) missense probably damaging 1.00
R1770:Trpv2 UTSW 11 62,487,787 (GRCm39) missense probably benign 0.12
R1772:Trpv2 UTSW 11 62,485,052 (GRCm39) splice site probably benign
R2143:Trpv2 UTSW 11 62,483,612 (GRCm39) missense probably benign 0.05
R4743:Trpv2 UTSW 11 62,483,627 (GRCm39) missense probably benign 0.00
R4795:Trpv2 UTSW 11 62,472,006 (GRCm39) missense possibly damaging 0.89
R5321:Trpv2 UTSW 11 62,475,397 (GRCm39) missense probably damaging 1.00
R6856:Trpv2 UTSW 11 62,475,441 (GRCm39) missense probably benign 0.00
R7024:Trpv2 UTSW 11 62,475,287 (GRCm39) missense probably benign 0.03
R7168:Trpv2 UTSW 11 62,473,914 (GRCm39) missense probably benign 0.19
R7488:Trpv2 UTSW 11 62,480,576 (GRCm39) missense probably damaging 1.00
R7633:Trpv2 UTSW 11 62,481,832 (GRCm39) critical splice donor site probably null
R8215:Trpv2 UTSW 11 62,481,757 (GRCm39) missense probably damaging 0.99
R8878:Trpv2 UTSW 11 62,481,112 (GRCm39) missense probably benign
R9037:Trpv2 UTSW 11 62,475,231 (GRCm39) missense probably damaging 0.99
R9619:Trpv2 UTSW 11 62,480,562 (GRCm39) missense probably damaging 1.00
R9664:Trpv2 UTSW 11 62,475,385 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGAAAGTATAGTTAAGCCTGCTGG -3'
(R):5'- GACTTGGGTACATGCTGAGCTTCC -3'

Sequencing Primer
(F):5'- CAATGAAGTTGTGTTCCCACCAG -3'
(R):5'- cgccagctctgccaatc -3'
Posted On 2013-06-12