Incidental Mutation 'R0506:Sp8'
ID47605
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Nametrans-acting transcription factor 8
SynonymsmBtd, D930049B17Rik
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R0506 (G1)
Quality Score173
Status Validated
Chromosome12
Chromosomal Location118846329-118852576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118848565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 52 (S52P)
Ref Sequence ENSEMBL: ENSMUSP00000065746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
AlphaFold Q8BMJ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000063918
AA Change: S52P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: S52P

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223305
AA Change: S52P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118848970 missense probably damaging 1.00
IGL01783:Sp8 APN 12 118849024 missense probably benign 0.01
IGL02745:Sp8 APN 12 118849591 missense probably damaging 0.97
R0699:Sp8 UTSW 12 118848820 small deletion probably benign
R1742:Sp8 UTSW 12 118849817 missense probably benign 0.04
R1771:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1776:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1791:Sp8 UTSW 12 118849016 missense possibly damaging 0.84
R1926:Sp8 UTSW 12 118849229 missense possibly damaging 0.55
R2159:Sp8 UTSW 12 118848706 missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118849738 missense probably damaging 0.99
R2304:Sp8 UTSW 12 118848569 missense possibly damaging 0.92
R3777:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118848436 missense probably benign 0.33
R4360:Sp8 UTSW 12 118848665 missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118849203 missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118849070 missense probably damaging 0.98
R4982:Sp8 UTSW 12 118848425 missense probably damaging 0.99
R5053:Sp8 UTSW 12 118849604 missense probably damaging 1.00
R5347:Sp8 UTSW 12 118848511 missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118849087 missense probably damaging 0.96
R6219:Sp8 UTSW 12 118848667 missense probably benign 0.27
R7672:Sp8 UTSW 12 118849335 missense possibly damaging 0.47
R7793:Sp8 UTSW 12 118849409 missense probably damaging 0.98
R8548:Sp8 UTSW 12 118849175 missense possibly damaging 0.93
R8990:Sp8 UTSW 12 118849387 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTGCTCCAGAATCAGACGCTCG -3'
(R):5'- GCCTGGAACACAGAGTAGTCGTTG -3'

Sequencing Primer
(F):5'- CCAGGGGACTAATACACATTTCTTTC -3'
(R):5'- TAGTCGTTGGCAAAGGGC -3'
Posted On2013-06-12