Incidental Mutation 'R0506:Sp8'
ID 47605
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Name trans-acting transcription factor 8
Synonyms mBtd, D930049B17Rik
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.704) question?
Stock # R0506 (G1)
Quality Score 173
Status Validated
Chromosome 12
Chromosomal Location 118810064-118816311 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118812300 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 52 (S52P)
Ref Sequence ENSEMBL: ENSMUSP00000065746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
AlphaFold Q8BMJ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000063918
AA Change: S52P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: S52P

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223305
AA Change: S52P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118,812,705 (GRCm39) missense probably damaging 1.00
IGL01783:Sp8 APN 12 118,812,759 (GRCm39) missense probably benign 0.01
IGL02745:Sp8 APN 12 118,813,326 (GRCm39) missense probably damaging 0.97
R0699:Sp8 UTSW 12 118,812,555 (GRCm39) small deletion probably benign
R1742:Sp8 UTSW 12 118,813,552 (GRCm39) missense probably benign 0.04
R1771:Sp8 UTSW 12 118,813,302 (GRCm39) missense probably damaging 1.00
R1776:Sp8 UTSW 12 118,813,302 (GRCm39) missense probably damaging 1.00
R1791:Sp8 UTSW 12 118,812,751 (GRCm39) missense possibly damaging 0.84
R1926:Sp8 UTSW 12 118,812,964 (GRCm39) missense possibly damaging 0.55
R2159:Sp8 UTSW 12 118,812,441 (GRCm39) missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118,813,473 (GRCm39) missense probably damaging 0.99
R2304:Sp8 UTSW 12 118,812,304 (GRCm39) missense possibly damaging 0.92
R3777:Sp8 UTSW 12 118,812,750 (GRCm39) missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118,812,750 (GRCm39) missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118,812,750 (GRCm39) missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118,812,171 (GRCm39) missense probably benign 0.33
R4360:Sp8 UTSW 12 118,812,400 (GRCm39) missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118,812,938 (GRCm39) missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118,812,805 (GRCm39) missense probably damaging 0.98
R4982:Sp8 UTSW 12 118,812,160 (GRCm39) missense probably damaging 0.99
R5053:Sp8 UTSW 12 118,813,339 (GRCm39) missense probably damaging 1.00
R5347:Sp8 UTSW 12 118,812,246 (GRCm39) missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118,812,822 (GRCm39) missense probably damaging 0.96
R6219:Sp8 UTSW 12 118,812,402 (GRCm39) missense probably benign 0.27
R7672:Sp8 UTSW 12 118,813,070 (GRCm39) missense possibly damaging 0.47
R7793:Sp8 UTSW 12 118,813,144 (GRCm39) missense probably damaging 0.98
R8548:Sp8 UTSW 12 118,812,910 (GRCm39) missense possibly damaging 0.93
R8990:Sp8 UTSW 12 118,813,122 (GRCm39) missense possibly damaging 0.95
R9139:Sp8 UTSW 12 118,812,174 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCCAGAATCAGACGCTCG -3'
(R):5'- GCCTGGAACACAGAGTAGTCGTTG -3'

Sequencing Primer
(F):5'- CCAGGGGACTAATACACATTTCTTTC -3'
(R):5'- TAGTCGTTGGCAAAGGGC -3'
Posted On 2013-06-12