Incidental Mutation 'R0506:Map3k1'
ID 47609
Institutional Source Beutler Lab
Gene Symbol Map3k1
Ensembl Gene ENSMUSG00000021754
Gene Name mitogen-activated protein kinase kinase kinase 1
Synonyms MEKK1, Mekk
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.909) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 111882962-111945527 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 111892298 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 986 (R986*)
Ref Sequence ENSEMBL: ENSMUSP00000104890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109267]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000109267
AA Change: R986*
SMART Domains Protein: ENSMUSP00000104890
Gene: ENSMUSG00000021754
AA Change: R986*

DomainStartEndE-ValueType
low complexity region 2 46 N/A INTRINSIC
low complexity region 85 101 N/A INTRINSIC
low complexity region 112 122 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
Pfam:SWIM 333 361 3.1e-7 PFAM
low complexity region 417 426 N/A INTRINSIC
RING 438 486 2.69e-1 SMART
low complexity region 512 527 N/A INTRINSIC
low complexity region 596 625 N/A INTRINSIC
low complexity region 750 762 N/A INTRINSIC
low complexity region 967 978 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1160 1178 N/A INTRINSIC
S_TKc 1224 1489 9.58e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175936
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase and is part of some signal transduction cascades, including the ERK and JNK kinase pathways as well as the NF-kappa-B pathway. The encoded protein is activated by autophosphorylation and requires magnesium as a cofactor in phosphorylating other proteins. This protein has E3 ligase activity conferred by a plant homeodomain (PHD) in its N-terminus and phospho-kinase activity conferred by a kinase domain in its C-terminus. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a spontaneous allele are born with one or both eyes open, defects in eye morphology, and defects in ear morphology and function. Mice homozygous for a knock-out allele are born with open eyes and exhibit increased response to aortic banding and blood vessel healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Map3k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01594:Map3k1 APN 13 111,894,723 (GRCm39) critical splice acceptor site probably null
IGL01686:Map3k1 APN 13 111,891,196 (GRCm39) missense possibly damaging 0.51
IGL02104:Map3k1 APN 13 111,892,777 (GRCm39) missense probably damaging 0.99
IGL03071:Map3k1 APN 13 111,892,059 (GRCm39) missense possibly damaging 0.77
IGL03087:Map3k1 APN 13 111,885,559 (GRCm39) missense probably benign 0.01
IGL03213:Map3k1 APN 13 111,885,426 (GRCm39) utr 3 prime probably benign
Nepal UTSW 13 111,888,983 (GRCm39) missense probably benign 0.07
Snow_leopard UTSW 13 111,892,298 (GRCm39) nonsense probably null
R0005:Map3k1 UTSW 13 111,892,238 (GRCm39) missense probably benign 0.00
R0025:Map3k1 UTSW 13 111,892,663 (GRCm39) missense probably benign
R0540:Map3k1 UTSW 13 111,900,044 (GRCm39) missense probably benign 0.05
R0607:Map3k1 UTSW 13 111,900,044 (GRCm39) missense probably benign 0.05
R0898:Map3k1 UTSW 13 111,904,490 (GRCm39) unclassified probably benign
R1171:Map3k1 UTSW 13 111,892,177 (GRCm39) missense probably benign 0.29
R1464:Map3k1 UTSW 13 111,892,405 (GRCm39) missense possibly damaging 0.67
R1464:Map3k1 UTSW 13 111,892,405 (GRCm39) missense possibly damaging 0.67
R1682:Map3k1 UTSW 13 111,893,684 (GRCm39) missense probably damaging 1.00
R1718:Map3k1 UTSW 13 111,891,953 (GRCm39) missense probably benign 0.23
R1893:Map3k1 UTSW 13 111,904,567 (GRCm39) missense possibly damaging 0.91
R2174:Map3k1 UTSW 13 111,889,016 (GRCm39) missense possibly damaging 0.75
R2215:Map3k1 UTSW 13 111,892,322 (GRCm39) missense probably benign 0.00
R2239:Map3k1 UTSW 13 111,885,478 (GRCm39) missense probably benign 0.00
R3686:Map3k1 UTSW 13 111,890,425 (GRCm39) missense probably damaging 0.99
R3783:Map3k1 UTSW 13 111,892,754 (GRCm39) missense probably benign 0.00
R4094:Map3k1 UTSW 13 111,892,696 (GRCm39) missense possibly damaging 0.48
R4231:Map3k1 UTSW 13 111,905,028 (GRCm39) missense probably benign 0.01
R4902:Map3k1 UTSW 13 111,909,146 (GRCm39) missense probably damaging 0.99
R4967:Map3k1 UTSW 13 111,909,272 (GRCm39) missense probably damaging 0.96
R5465:Map3k1 UTSW 13 111,892,654 (GRCm39) missense probably benign 0.20
R5855:Map3k1 UTSW 13 111,892,513 (GRCm39) missense probably benign 0.37
R6384:Map3k1 UTSW 13 111,887,064 (GRCm39) missense probably damaging 1.00
R6389:Map3k1 UTSW 13 111,905,975 (GRCm39) missense probably damaging 1.00
R6400:Map3k1 UTSW 13 111,892,259 (GRCm39) missense probably damaging 0.99
R6509:Map3k1 UTSW 13 111,890,363 (GRCm39) missense possibly damaging 0.48
R6644:Map3k1 UTSW 13 111,888,983 (GRCm39) missense probably benign 0.07
R6900:Map3k1 UTSW 13 111,890,350 (GRCm39) missense probably benign 0.01
R6943:Map3k1 UTSW 13 111,909,246 (GRCm39) missense probably benign 0.30
R6946:Map3k1 UTSW 13 111,905,035 (GRCm39) nonsense probably null
R7059:Map3k1 UTSW 13 111,909,312 (GRCm39) missense probably benign
R7271:Map3k1 UTSW 13 111,893,231 (GRCm39) missense probably benign 0.32
R7290:Map3k1 UTSW 13 111,904,645 (GRCm39) missense probably damaging 1.00
R7397:Map3k1 UTSW 13 111,891,742 (GRCm39) missense probably damaging 0.98
R7457:Map3k1 UTSW 13 111,892,789 (GRCm39) missense probably damaging 0.99
R7827:Map3k1 UTSW 13 111,892,663 (GRCm39) missense probably benign
R7990:Map3k1 UTSW 13 111,892,696 (GRCm39) missense probably benign 0.28
R8110:Map3k1 UTSW 13 111,891,847 (GRCm39) missense probably damaging 0.98
R8119:Map3k1 UTSW 13 111,909,156 (GRCm39) missense possibly damaging 0.89
R8179:Map3k1 UTSW 13 111,885,581 (GRCm39) missense probably damaging 1.00
R8317:Map3k1 UTSW 13 111,894,696 (GRCm39) missense probably damaging 1.00
R8397:Map3k1 UTSW 13 111,892,138 (GRCm39) missense probably damaging 0.99
R8745:Map3k1 UTSW 13 111,893,306 (GRCm39) missense probably damaging 1.00
R8829:Map3k1 UTSW 13 111,889,015 (GRCm39) missense possibly damaging 0.88
R8832:Map3k1 UTSW 13 111,889,015 (GRCm39) missense possibly damaging 0.88
R8939:Map3k1 UTSW 13 111,892,837 (GRCm39) nonsense probably null
R9640:Map3k1 UTSW 13 111,900,699 (GRCm39) nonsense probably null
R9649:Map3k1 UTSW 13 111,885,478 (GRCm39) missense probably damaging 0.97
R9653:Map3k1 UTSW 13 111,890,296 (GRCm39) missense possibly damaging 0.94
R9763:Map3k1 UTSW 13 111,912,499 (GRCm39) missense probably damaging 1.00
R9768:Map3k1 UTSW 13 111,904,630 (GRCm39) missense probably benign 0.04
X0065:Map3k1 UTSW 13 111,893,639 (GRCm39) missense probably damaging 1.00
Z1177:Map3k1 UTSW 13 111,892,480 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGATCAAGTGTCATGCTAC -3'
(R):5'- ACTAAGTGCTACGAGACTGAGTGCC -3'

Sequencing Primer
(F):5'- TGCTTGTACTGCCCGGAAC -3'
(R):5'- CTCGGAGGACATTTCTGACAGAC -3'
Posted On 2013-06-12