Incidental Mutation 'R0506:Dock5'
ID 47611
Institutional Source Beutler Lab
Gene Symbol Dock5
Ensembl Gene ENSMUSG00000044447
Gene Name dedicator of cytokinesis 5
Synonyms lr2, 1110060D06Rik, rlc
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.301) question?
Stock # R0506 (G1)
Quality Score 213
Status Validated
Chromosome 14
Chromosomal Location 67752135-67933442 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 67784792 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000036674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039135]
AlphaFold B2RY04
Predicted Effect probably benign
Transcript: ENSMUST00000039135
SMART Domains Protein: ENSMUSP00000036674
Gene: ENSMUSG00000044447

DomainStartEndE-ValueType
SH3 11 68 1.45e-13 SMART
Pfam:DOCK_N 71 434 9e-110 PFAM
Pfam:DOCK-C2 439 636 1.1e-57 PFAM
low complexity region 752 764 N/A INTRINSIC
Pfam:DHR-2 1133 1635 6.4e-99 PFAM
low complexity region 1663 1692 N/A INTRINSIC
low complexity region 1815 1824 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mutations at this locus result in lens abnormalities involving cataracts and rupturing of the lens nucleus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 (GRCm38) C378* probably null Het
Ago3 T C 4: 126,417,252 (GRCm38) D56G possibly damaging Het
Ahnak G T 19: 9,009,128 (GRCm38) G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 (GRCm38) G470D probably damaging Het
Ankub1 T A 3: 57,690,375 (GRCm38) N58I probably damaging Het
Apol7b G T 15: 77,425,528 (GRCm38) T23K probably benign Het
Arap2 G A 5: 62,606,131 (GRCm38) P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 (GRCm38) Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 (GRCm38) F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 (GRCm38) C109S probably damaging Het
Catsperd A G 17: 56,658,078 (GRCm38) K475R possibly damaging Het
Cblb A G 16: 52,204,480 (GRCm38) T913A probably benign Het
Cbx6 A G 15: 79,828,203 (GRCm38) L341P probably benign Het
Cd177 T C 7: 24,758,356 (GRCm38) Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 (GRCm38) N530D probably damaging Het
Cdk8 T C 5: 146,298,872 (GRCm38) F270L probably damaging Het
Ces2c A T 8: 104,848,024 (GRCm38) T38S probably damaging Het
Chst14 T C 2: 118,927,721 (GRCm38) L357P probably damaging Het
Clca3b T A 3: 144,822,866 (GRCm38) probably benign Het
Cluh A G 11: 74,664,894 (GRCm38) S839G probably benign Het
Cnga4 T A 7: 105,407,740 (GRCm38) V350E probably damaging Het
Creb1 G A 1: 64,570,267 (GRCm38) G180R probably damaging Het
Csmd3 T C 15: 48,457,511 (GRCm38) E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 (GRCm38) D268E probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm38) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm38) H224L probably benign Het
Dzip1l C A 9: 99,663,081 (GRCm38) Q585K possibly damaging Het
Erf C T 7: 25,244,376 (GRCm38) G510D probably damaging Het
Fanci T C 7: 79,432,178 (GRCm38) L623P probably benign Het
Fat1 T C 8: 45,022,951 (GRCm38) V1655A probably damaging Het
Fat4 T C 3: 38,888,314 (GRCm38) V452A probably benign Het
Gal3st4 C T 5: 138,265,889 (GRCm38) G283S probably benign Het
Gm5422 A G 10: 31,250,322 (GRCm38) noncoding transcript Het
Gnal C T 18: 67,088,673 (GRCm38) T49I unknown Het
Gng5 A G 3: 146,503,348 (GRCm38) N57S probably damaging Het
Herc1 A G 9: 66,448,159 (GRCm38) I2231V probably damaging Het
Hgfac G T 5: 35,044,240 (GRCm38) G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 (GRCm38) D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 (GRCm38) Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 (GRCm38) E98K probably damaging Het
Lepr G T 4: 101,773,010 (GRCm38) probably benign Het
Lyst A G 13: 13,638,015 (GRCm38) H1004R probably benign Het
Map3k1 T A 13: 111,755,764 (GRCm38) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm38) Q66H possibly damaging Het
Mpo T C 11: 87,803,504 (GRCm38) S107P probably benign Het
Mroh9 T C 1: 163,060,636 (GRCm38) H290R possibly damaging Het
Myo7b A G 18: 31,964,386 (GRCm38) probably null Het
Myom1 T C 17: 71,092,220 (GRCm38) probably benign Het
Nalcn C T 14: 123,596,614 (GRCm38) V50I possibly damaging Het
Negr1 A G 3: 157,160,748 (GRCm38) probably benign Het
Nlrc5 T G 8: 94,493,125 (GRCm38) probably benign Het
Nyap2 G A 1: 81,087,312 (GRCm38) D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 (GRCm38) R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 (GRCm38) I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 (GRCm38) G188W probably damaging Het
Parp14 A T 16: 35,841,409 (GRCm38) S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 (GRCm38) F2347S probably damaging Het
Pigf A G 17: 87,008,909 (GRCm38) V147A probably benign Het
Pkhd1 A T 1: 20,559,469 (GRCm38) M637K probably benign Het
Plce1 T C 19: 38,760,138 (GRCm38) I1771T probably benign Het
Ppp6c A T 2: 39,206,648 (GRCm38) probably benign Het
Prag1 T C 8: 36,103,700 (GRCm38) V479A possibly damaging Het
Prss33 A T 17: 23,835,105 (GRCm38) D42E probably benign Het
Psmb10 A G 8: 105,937,545 (GRCm38) V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 (GRCm38) T306A probably benign Het
Psmg1 C T 16: 95,989,487 (GRCm38) probably benign Het
Rc3h2 A T 2: 37,376,659 (GRCm38) probably null Het
Reln C T 5: 21,920,496 (GRCm38) V2730I probably damaging Het
Sec24a A T 11: 51,743,795 (GRCm38) H101Q probably benign Het
Selenoi A G 5: 30,266,956 (GRCm38) N385S probably benign Het
Slc24a4 T C 12: 102,131,623 (GRCm38) probably null Het
Slc4a10 G A 2: 62,250,533 (GRCm38) S338N probably benign Het
Slfn3 A T 11: 83,213,160 (GRCm38) T286S probably damaging Het
Snx29 A G 16: 11,395,303 (GRCm38) D111G probably benign Het
Sp8 T C 12: 118,848,565 (GRCm38) S52P possibly damaging Het
Srek1 G T 13: 103,760,590 (GRCm38) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm38) Q265H unknown Het
Taf3 A G 2: 9,940,993 (GRCm38) V600A probably benign Het
Tatdn2 C A 6: 113,702,589 (GRCm38) D298E probably benign Het
Tmem253 A T 14: 52,017,206 (GRCm38) probably benign Het
Tmem63a T A 1: 180,958,049 (GRCm38) probably null Het
Tmprss11b T C 5: 86,661,640 (GRCm38) D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 (GRCm38) K143* probably null Het
Trappc8 A T 18: 20,844,188 (GRCm38) N841K possibly damaging Het
Trio T C 15: 27,854,963 (GRCm38) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm38) T114N probably damaging Het
Trpv2 C A 11: 62,582,906 (GRCm38) A129D probably benign Het
Ttll4 T G 1: 74,688,618 (GRCm38) D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 (GRCm38) L172P possibly damaging Het
Usp19 T A 9: 108,494,487 (GRCm38) F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 (GRCm38) G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 (GRCm38) D443E probably benign Het
Wee2 A T 6: 40,463,253 (GRCm38) E445V probably benign Het
Zer1 A T 2: 30,101,807 (GRCm38) I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 (GRCm38) L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 (GRCm38) Q157* probably null Het
Zfp964 T A 8: 69,663,937 (GRCm38) C396S unknown Het
Other mutations in Dock5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Dock5 APN 14 67,786,889 (GRCm38) splice site probably benign
IGL00930:Dock5 APN 14 67,771,077 (GRCm38) missense probably damaging 1.00
IGL01525:Dock5 APN 14 67,805,720 (GRCm38) splice site probably benign
IGL01759:Dock5 APN 14 67,881,259 (GRCm38) nonsense probably null
IGL01941:Dock5 APN 14 67,812,232 (GRCm38) missense probably damaging 1.00
IGL02025:Dock5 APN 14 67,763,287 (GRCm38) missense probably damaging 1.00
IGL02093:Dock5 APN 14 67,839,543 (GRCm38) splice site probably benign
IGL02179:Dock5 APN 14 67,806,496 (GRCm38) splice site probably benign
IGL02208:Dock5 APN 14 67,828,450 (GRCm38) missense probably benign 0.06
IGL02605:Dock5 APN 14 67,828,438 (GRCm38) missense probably benign 0.18
IGL02608:Dock5 APN 14 67,828,439 (GRCm38) missense probably benign 0.01
IGL02938:Dock5 APN 14 67,757,218 (GRCm38) splice site probably benign
IGL02971:Dock5 APN 14 67,757,109 (GRCm38) missense probably null 1.00
IGL02983:Dock5 APN 14 67,764,670 (GRCm38) missense probably damaging 1.00
IGL03151:Dock5 APN 14 67,866,067 (GRCm38) missense probably damaging 1.00
IGL03410:Dock5 APN 14 67,846,086 (GRCm38) missense probably benign 0.04
PIT4366001:Dock5 UTSW 14 67,824,674 (GRCm38) missense possibly damaging 0.83
R0026:Dock5 UTSW 14 67,846,081 (GRCm38) missense probably benign 0.00
R0058:Dock5 UTSW 14 67,781,036 (GRCm38) missense probably benign 0.00
R0058:Dock5 UTSW 14 67,781,036 (GRCm38) missense probably benign 0.00
R0112:Dock5 UTSW 14 67,819,641 (GRCm38) missense probably benign
R0127:Dock5 UTSW 14 67,846,042 (GRCm38) missense probably benign 0.13
R0144:Dock5 UTSW 14 67,786,286 (GRCm38) missense probably benign 0.18
R0312:Dock5 UTSW 14 67,795,991 (GRCm38) missense possibly damaging 0.82
R0360:Dock5 UTSW 14 67,822,680 (GRCm38) splice site probably benign
R0364:Dock5 UTSW 14 67,822,680 (GRCm38) splice site probably benign
R0496:Dock5 UTSW 14 67,817,518 (GRCm38) missense probably damaging 1.00
R0586:Dock5 UTSW 14 67,809,032 (GRCm38) missense probably damaging 1.00
R0597:Dock5 UTSW 14 67,784,934 (GRCm38) splice site probably null
R0625:Dock5 UTSW 14 67,841,163 (GRCm38) missense probably benign
R1109:Dock5 UTSW 14 67,806,478 (GRCm38) missense possibly damaging 0.80
R1221:Dock5 UTSW 14 67,759,161 (GRCm38) missense probably benign 0.00
R1278:Dock5 UTSW 14 67,839,566 (GRCm38) missense possibly damaging 0.80
R1927:Dock5 UTSW 14 67,846,062 (GRCm38) missense possibly damaging 0.60
R1944:Dock5 UTSW 14 67,757,135 (GRCm38) nonsense probably null
R1946:Dock5 UTSW 14 67,786,316 (GRCm38) missense probably damaging 1.00
R2046:Dock5 UTSW 14 67,812,142 (GRCm38) missense probably benign
R2101:Dock5 UTSW 14 67,794,010 (GRCm38) missense probably benign 0.02
R2252:Dock5 UTSW 14 67,784,812 (GRCm38) missense probably damaging 0.98
R2882:Dock5 UTSW 14 67,839,620 (GRCm38) missense probably damaging 0.99
R3110:Dock5 UTSW 14 67,857,922 (GRCm38) missense possibly damaging 0.72
R3112:Dock5 UTSW 14 67,857,922 (GRCm38) missense possibly damaging 0.72
R4236:Dock5 UTSW 14 67,756,492 (GRCm38) missense probably benign 0.02
R4242:Dock5 UTSW 14 67,828,490 (GRCm38) missense probably benign 0.19
R4244:Dock5 UTSW 14 67,774,582 (GRCm38) missense probably benign 0.41
R4646:Dock5 UTSW 14 67,842,779 (GRCm38) missense probably benign 0.01
R4793:Dock5 UTSW 14 67,800,354 (GRCm38) missense probably benign 0.26
R4841:Dock5 UTSW 14 67,817,563 (GRCm38) missense probably damaging 0.98
R4842:Dock5 UTSW 14 67,817,563 (GRCm38) missense probably damaging 0.98
R5159:Dock5 UTSW 14 67,792,289 (GRCm38) missense probably benign 0.04
R5164:Dock5 UTSW 14 67,817,661 (GRCm38) nonsense probably null
R5206:Dock5 UTSW 14 67,763,184 (GRCm38) missense probably benign 0.35
R5207:Dock5 UTSW 14 67,776,284 (GRCm38) missense probably benign 0.06
R5322:Dock5 UTSW 14 67,770,266 (GRCm38) missense probably benign 0.41
R5374:Dock5 UTSW 14 67,805,756 (GRCm38) missense possibly damaging 0.81
R5413:Dock5 UTSW 14 67,764,655 (GRCm38) missense probably damaging 1.00
R5476:Dock5 UTSW 14 67,814,007 (GRCm38) missense possibly damaging 0.92
R5504:Dock5 UTSW 14 67,803,086 (GRCm38) missense probably benign 0.01
R5677:Dock5 UTSW 14 67,777,603 (GRCm38) missense probably benign 0.00
R5773:Dock5 UTSW 14 67,796,058 (GRCm38) missense possibly damaging 0.95
R5845:Dock5 UTSW 14 67,841,101 (GRCm38) missense possibly damaging 0.82
R5957:Dock5 UTSW 14 67,857,994 (GRCm38) missense probably benign
R6154:Dock5 UTSW 14 67,859,912 (GRCm38) missense probably benign 0.03
R6268:Dock5 UTSW 14 67,790,275 (GRCm38) nonsense probably null
R6393:Dock5 UTSW 14 67,822,602 (GRCm38) missense probably benign 0.32
R6512:Dock5 UTSW 14 67,824,648 (GRCm38) missense possibly damaging 0.93
R6759:Dock5 UTSW 14 67,795,996 (GRCm38) missense probably benign 0.00
R7012:Dock5 UTSW 14 67,822,586 (GRCm38) missense probably damaging 1.00
R7061:Dock5 UTSW 14 67,770,254 (GRCm38) missense probably damaging 0.96
R7196:Dock5 UTSW 14 67,756,470 (GRCm38) missense probably damaging 1.00
R7200:Dock5 UTSW 14 67,771,702 (GRCm38) nonsense probably null
R7311:Dock5 UTSW 14 67,828,502 (GRCm38) missense probably benign 0.25
R7359:Dock5 UTSW 14 67,765,888 (GRCm38) missense probably benign 0.10
R7422:Dock5 UTSW 14 67,809,030 (GRCm38) missense probably benign 0.01
R7588:Dock5 UTSW 14 67,763,158 (GRCm38) critical splice donor site probably null
R7637:Dock5 UTSW 14 67,786,340 (GRCm38) missense possibly damaging 0.95
R7709:Dock5 UTSW 14 67,796,005 (GRCm38) missense probably benign 0.44
R7763:Dock5 UTSW 14 67,821,327 (GRCm38) missense probably damaging 0.97
R8044:Dock5 UTSW 14 67,824,692 (GRCm38) missense probably damaging 1.00
R8076:Dock5 UTSW 14 67,802,977 (GRCm38) splice site probably null
R8168:Dock5 UTSW 14 67,770,197 (GRCm38) splice site probably null
R8353:Dock5 UTSW 14 67,817,508 (GRCm38) splice site probably null
R8480:Dock5 UTSW 14 67,836,410 (GRCm38) missense probably benign 0.32
R8535:Dock5 UTSW 14 67,793,976 (GRCm38) missense probably benign 0.19
R8708:Dock5 UTSW 14 67,767,371 (GRCm38) missense probably benign 0.02
R8732:Dock5 UTSW 14 67,846,000 (GRCm38) missense possibly damaging 0.85
R8888:Dock5 UTSW 14 67,817,663 (GRCm38) missense possibly damaging 0.95
R8895:Dock5 UTSW 14 67,817,663 (GRCm38) missense possibly damaging 0.95
R8936:Dock5 UTSW 14 67,845,990 (GRCm38) nonsense probably null
R8962:Dock5 UTSW 14 67,757,191 (GRCm38) missense probably benign
R8972:Dock5 UTSW 14 67,776,300 (GRCm38) missense probably damaging 1.00
R9244:Dock5 UTSW 14 67,759,114 (GRCm38) missense probably damaging 0.99
R9345:Dock5 UTSW 14 67,822,622 (GRCm38) missense possibly damaging 0.74
R9679:Dock5 UTSW 14 67,781,001 (GRCm38) missense probably damaging 1.00
X0023:Dock5 UTSW 14 67,771,088 (GRCm38) missense probably benign 0.15
Z1177:Dock5 UTSW 14 67,813,933 (GRCm38) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TCAGAACTCTTTGATGGCCTGCG -3'
(R):5'- TCCACGAACTTTGGAAACAGTCCTC -3'

Sequencing Primer
(F):5'- CAGGTTCATAATTAAGATGTCGGGC -3'
(R):5'- TCCTCAAATTGAAAGGGATTGAGC -3'
Posted On 2013-06-12