Mutagenetix > Incidental Mutations

Incidental Mutation 'R3713:Cux1'

476138

Institutional Source

Beutler Lab

Gene Symbol

Cux1

Ensembl Gene

ENSMUSG00000029705

Gene Name

cut-like homeobox 1

Synonyms

Cux-1, Cutl1, CDP, Cux

MMRRC Submission

040706-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.912) question?

Stock #

R3713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136248135-136567490 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to G at 136565543 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004097] [ENSMUST00000175918] [ENSMUST00000175975] [ENSMUST00000176172] [ENSMUST00000176216] [ENSMUST00000176745] [ENSMUST00000176778] [ENSMUST00000177297]

Predicted Effect

probably benign
Transcript: ENSMUST00000004097

SMART Domains

Protein: ENSMUSP00000004097
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
low complexity region	425	436	N/A	INTRINSIC
CUT	452	538	5.06e-39	SMART
low complexity region	602	608	N/A	INTRINSIC
low complexity region	620	642	N/A	INTRINSIC
CUT	841	929	3.31e-43	SMART
low complexity region	956	972	N/A	INTRINSIC
low complexity region	990	1011	N/A	INTRINSIC
CUT	1024	1110	3.78e-38	SMART
HOX	1150	1212	6.32e-15	SMART
low complexity region	1224	1239	N/A	INTRINSIC
low complexity region	1317	1379	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175918

SMART Domains

Protein: ENSMUSP00000135606
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	73	328	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175975

SMART Domains

Protein: ENSMUSP00000135223
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	1	169	N/A	INTRINSIC
low complexity region	235	251	N/A	INTRINSIC
low complexity region	277	289	N/A	INTRINSIC
low complexity region	331	342	N/A	INTRINSIC
CUT	358	444	5.06e-39	SMART
low complexity region	508	514	N/A	INTRINSIC
low complexity region	526	548	N/A	INTRINSIC
CUT	747	835	3.31e-43	SMART
low complexity region	862	878	N/A	INTRINSIC
low complexity region	896	917	N/A	INTRINSIC
CUT	930	1016	3.78e-38	SMART
HOX	1056	1118	6.32e-15	SMART
low complexity region	1130	1145	N/A	INTRINSIC
low complexity region	1223	1285	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176172

SMART Domains

Protein: ENSMUSP00000135086
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	99	354	N/A	INTRINSIC
low complexity region	420	436	N/A	INTRINSIC
low complexity region	462	474	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
CUT	543	629	5.06e-39	SMART
low complexity region	693	699	N/A	INTRINSIC
low complexity region	711	733	N/A	INTRINSIC
CUT	932	1020	3.31e-43	SMART
low complexity region	1047	1063	N/A	INTRINSIC
low complexity region	1081	1102	N/A	INTRINSIC
CUT	1115	1201	3.78e-38	SMART
HOX	1241	1303	6.32e-15	SMART
low complexity region	1315	1330	N/A	INTRINSIC
low complexity region	1408	1470	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176216

SMART Domains

Protein: ENSMUSP00000135054
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	9.35e-5	PROSPERO
Pfam:CASP_C	421	647	1.2e-71	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176501

Predicted Effect

probably benign
Transcript: ENSMUST00000176745

SMART Domains

Protein: ENSMUSP00000135512
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	363	N/A	INTRINSIC
internal_repeat_1	367	388	8.95e-5	PROSPERO
Pfam:CASP_C	419	645	1.2e-71	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000176778
AA Change: L52P

SMART Domains

Protein: ENSMUSP00000135892
Gene: ENSMUSG00000029705
AA Change: L52P

Domain	Start	End	E-Value	Type
low complexity region	78	86	N/A	INTRINSIC
coiled coil region	195	448	N/A	INTRINSIC
low complexity region	508	519	N/A	INTRINSIC
CUT	535	621	5.06e-39	SMART
low complexity region	685	691	N/A	INTRINSIC
low complexity region	703	725	N/A	INTRINSIC
CUT	924	1012	3.31e-43	SMART
low complexity region	1039	1055	N/A	INTRINSIC
low complexity region	1073	1094	N/A	INTRINSIC
CUT	1107	1193	3.78e-38	SMART
HOX	1233	1295	6.32e-15	SMART
low complexity region	1307	1322	N/A	INTRINSIC
low complexity region	1400	1462	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177297

SMART Domains

Protein: ENSMUSP00000134819
Gene: ENSMUSG00000029705

Domain	Start	End	E-Value	Type
coiled coil region	16	45	N/A	INTRINSIC
coiled coil region	110	365	N/A	INTRINSIC
internal_repeat_1	369	390	8.99e-6	PROSPERO
Pfam:CASP_C	422	527	1.8e-17	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177305

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit delayed lung development and neonatal mortality. Survivors show growth retardation and hair defects. Homozygotes for a partially deleted protein have curly hair, and females tend to lose their litters. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310079G19Rik	T	C	16: 88,627,193	M137V	probably benign	Het
Aak1	T	A	6: 86,955,190	I381N	probably benign	Het
Abcd4	C	T	12: 84,611,759	M223I	probably benign	Het
Adgrf2	A	G	17: 42,713,088	V164A	probably damaging	Het
Ahdc1	G	A	4: 133,065,986	A1513T	possibly damaging	Het
Akap13	T	C	7: 75,586,181	M168T	probably damaging	Het
Aox1	C	T	1: 58,056,215	T196I	probably benign	Het
Aqr	A	G	2: 114,118,669		probably benign	Het
Astn1	A	G	1: 158,667,532	E1042G	possibly damaging	Het
Azi2	A	G	9: 118,047,440	D8G	possibly damaging	Het
Bcam	T	C	7: 19,764,193	T302A	probably benign	Het
Cct6b	A	T	11: 82,760,357	I110N	probably damaging	Het
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Ceacam5	G	A	7: 17,759,338	S762N	possibly damaging	Het
Cecr2	T	C	6: 120,758,260	L819P	probably damaging	Het
Cers3	G	T	7: 66,786,075	A261S	probably benign	Het
Chd2	A	G	7: 73,471,790		probably benign	Het
Col7a1	G	T	9: 108,964,440	G1357*	probably null	Het
Cwh43	A	T	5: 73,438,492	I535F	probably damaging	Het
Dexi	A	T	16: 10,542,689	M1K	probably null	Het
Dnah12	T	C	14: 26,812,790	V2081A	probably benign	Het
Efcab5	A	T	11: 77,116,182	L872Q	probably damaging	Het
Enpp7	A	G	11: 118,990,518	Y163C	probably damaging	Het
Fam221a	T	C	6: 49,372,614	Y38H	probably damaging	Het
Foxred1	A	G	9: 35,210,890	M1T	probably null	Het
Fscn3	C	T	6: 28,428,092	T26I	possibly damaging	Het
Galp	A	T	7: 6,213,837	D72V	probably damaging	Het
Gm9843	A	G	16: 76,403,531		noncoding transcript	Het
Grm7	G	T	6: 110,646,348	V161F	probably damaging	Het
Lmbrd1	T	C	1: 24,692,995	Y98H	probably damaging	Het
Lrrc63	T	G	14: 75,107,336	Y437S	probably benign	Het
Macc1	A	G	12: 119,446,841	E448G	probably benign	Het
Madcam1	A	G	10: 79,668,360	H404R	probably benign	Het
Mink1	G	T	11: 70,608,950	R773L	possibly damaging	Het
Mroh2b	A	G	15: 4,943,649	I1045V	probably benign	Het
Mroh3	T	C	1: 136,185,976	T692A	probably benign	Het
Myo15	A	T	11: 60,479,231	E939V	possibly damaging	Het
Naip2	A	G	13: 100,161,902	F542S	probably damaging	Het
Napsa	A	G	7: 44,581,428	Y73C	probably damaging	Het
Ndst4	A	T	3: 125,561,505	H354L	possibly damaging	Het
Neil1	A	T	9: 57,146,970	V22E	probably damaging	Het
Nol4	T	C	18: 23,039,937	I36V	probably damaging	Het
Nprl3	G	A	11: 32,255,464	T111I	probably damaging	Het
Olfr1184	C	A	2: 88,487,443	T237N	probably damaging	Het
Olfr361	A	G	2: 37,085,505	M81T	possibly damaging	Het
Olfr385	A	T	11: 73,588,905	Y278N	probably damaging	Het
Pald1	G	A	10: 61,342,365	T624I	possibly damaging	Het
Pcdhb13	C	T	18: 37,443,733	P388L	probably damaging	Het
Pcdhga6	T	C	18: 37,707,923	V232A	probably damaging	Het
Pde6b	A	G	5: 108,423,062	I388V	probably damaging	Het
Phactr2	C	A	10: 13,388,732		probably benign	Het
Prdx5	T	C	19: 6,908,109	D56G	probably damaging	Het
Ptprh	A	T	7: 4,571,970	I350N	probably damaging	Het
Rangap1	C	A	15: 81,710,460	E389D	probably benign	Het
Reln	A	G	5: 21,904,734	V3126A	probably damaging	Het
Rpl21	G	A	5: 146,835,037	G59S	possibly damaging	Het
Rsph6a	G	A	7: 19,057,550	V215M	probably damaging	Het
Smcp	T	C	3: 92,584,124	K139E	unknown	Het
Stag1	A	G	9: 100,889,618	T699A	probably benign	Het
Tarsl2	G	A	7: 65,688,952		probably null	Het
Tle1	G	T	4: 72,126,422	H459Q	possibly damaging	Het
Ttn	G	A	2: 76,731,019	P27302S	probably damaging	Het
Ttn	C	T	2: 76,741,266	V26428I	probably damaging	Het
Usp53	T	C	3: 122,949,319	E656G	probably benign	Het
Vmn1r218	A	T	13: 23,136,911	N63Y	probably damaging	Het
Vmn1r79	A	G	7: 12,176,212	N40S	possibly damaging	Het
Wdr35	A	G	12: 9,027,648	D1107G	possibly damaging	Het
Zfp101	A	G	17: 33,381,906	M292T	probably benign	Het
Zfp108	T	A	7: 24,261,845	C620*	probably null	Het
Zscan4b	T	C	7: 10,901,891	T170A	probably benign	Het

Other mutations in Cux1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00846:Cux1	APN	5	136326796	missense	probably damaging	1.00
IGL00966:Cux1	APN	5	136311491	intron	probably benign
IGL01129:Cux1	APN	5	136304718	intron	probably benign
IGL01885:Cux1	APN	5	136308447	missense	possibly damaging	0.90
IGL01947:Cux1	APN	5	136275125	missense	probably benign	0.04
IGL02259:Cux1	APN	5	136326833	missense	probably damaging	1.00
IGL02666:Cux1	APN	5	136275315	nonsense	probably null
IGL02826:Cux1	APN	5	136308003	missense	probably damaging	1.00
IGL03014:Cux1	UTSW	5	136565525	intron	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0047:Cux1	UTSW	5	136363253	splice site	probably benign
R0057:Cux1	UTSW	5	136256282	missense	probably damaging	1.00
R0149:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0295:Cux1	UTSW	5	136313212	missense	probably benign	0.04
R0361:Cux1	UTSW	5	136279497	missense	probably damaging	1.00
R0533:Cux1	UTSW	5	136307859	missense	probably damaging	1.00
R0630:Cux1	UTSW	5	136286835	missense	probably damaging	1.00
R0801:Cux1	UTSW	5	136326929	missense	probably damaging	0.97
R0884:Cux1	UTSW	5	136307835	missense	probably damaging	1.00
R0976:Cux1	UTSW	5	136313290	missense	probably damaging	1.00
R1073:Cux1	UTSW	5	136252541	critical splice donor site	probably null
R1222:Cux1	UTSW	5	136275149	missense	probably benign	0.18
R1518:Cux1	UTSW	5	136308279	missense	probably benign	0.29
R1686:Cux1	UTSW	5	136275381	nonsense	probably null
R1687:Cux1	UTSW	5	136312669	missense	probably damaging	1.00
R1758:Cux1	UTSW	5	136392322	missense	probably damaging	1.00
R1797:Cux1	UTSW	5	136275315	missense	probably benign	0.22
R1919:Cux1	UTSW	5	136363319	nonsense	probably null
R2051:Cux1	UTSW	5	136332658	missense	probably damaging	1.00
R2339:Cux1	UTSW	5	136287008	missense	probably damaging	1.00
R3438:Cux1	UTSW	5	136311560	missense	probably damaging	0.97
R3800:Cux1	UTSW	5	136316033	missense	probably damaging	1.00
R3964:Cux1	UTSW	5	136282942	missense	probably damaging	1.00
R4135:Cux1	UTSW	5	136307896	missense	probably damaging	1.00
R4198:Cux1	UTSW	5	136286848	missense	probably damaging	1.00
R4467:Cux1	UTSW	5	136312722	missense	probably damaging	1.00
R4498:Cux1	UTSW	5	136312993	missense	probably damaging	1.00
R4622:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4623:Cux1	UTSW	5	136308300	missense	probably damaging	0.99
R4651:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4652:Cux1	UTSW	5	136567229	missense	probably damaging	1.00
R4658:Cux1	UTSW	5	136250594	missense	possibly damaging	0.80
R4665:Cux1	UTSW	5	136286799	missense	probably damaging	1.00
R4704:Cux1	UTSW	5	136249201	missense	probably benign	0.01
R4867:Cux1	UTSW	5	136274961	intron	probably benign
R4965:Cux1	UTSW	5	136311556	missense	possibly damaging	0.77
R5090:Cux1	UTSW	5	136313200	missense	possibly damaging	0.95
R5155:Cux1	UTSW	5	136565441	intron	probably benign
R5226:Cux1	UTSW	5	136370173	missense	probably benign	0.01
R5252:Cux1	UTSW	5	136308297	missense	probably damaging	0.98
R5266:Cux1	UTSW	5	136312694	missense	probably damaging	1.00
R5399:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R5509:Cux1	UTSW	5	136275317	missense	probably benign	0.13
R5609:Cux1	UTSW	5	136392320	missense	probably damaging	1.00
R5681:Cux1	UTSW	5	136308184	missense	probably damaging	1.00
R5993:Cux1	UTSW	5	136363271	missense	probably benign	0.00
R6049:Cux1	UTSW	5	136332710	missense	probably damaging	1.00
R6290:Cux1	UTSW	5	136311558	missense	probably damaging	0.99
R6310:Cux1	UTSW	5	136275164	missense	probably benign	0.10
R6351:Cux1	UTSW	5	136309792	missense	probably damaging	1.00
R6531:Cux1	UTSW	5	136275119	missense	probably benign	0.03
R6590:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6663:Cux1	UTSW	5	136485847	missense	probably damaging	1.00
R6690:Cux1	UTSW	5	136340117	missense	probably damaging	0.99
R6777:Cux1	UTSW	5	136565568	intron	probably benign
R6786:Cux1	UTSW	5	136567231	missense	probably damaging	1.00
R6817:Cux1	UTSW	5	136373173	splice site	probably null
R6989:Cux1	UTSW	5	136279648	nonsense	probably null
R7011:Cux1	UTSW	5	136360033	missense	probably damaging	1.00
R7167:Cux1	UTSW	5	136310041	splice site	probably null
R7699:Cux1	UTSW	5	136485739	critical splice donor site	probably null
R7861:Cux1	UTSW	5	136252604	missense	possibly damaging	0.58
R7876:Cux1	UTSW	5	136363307	missense	probably benign	0.00
R7916:Cux1	UTSW	5	136282961	missense	probably damaging	1.00
R8023:Cux1	UTSW	5	136373397	missense	probably damaging	0.99
R8154:Cux1	UTSW	5	136252580	missense	probably damaging	1.00
R8267:Cux1	UTSW	5	136282999	missense	probably damaging	1.00
R8289:Cux1	UTSW	5	136308504	missense	probably damaging	0.99
R8305:Cux1	UTSW	5	136360009	missense	probably benign	0.02
R8319:Cux1	UTSW	5	136565397	missense	probably benign	0.02
R8405:Cux1	UTSW	5	136275387	missense	possibly damaging	0.83
R8506:Cux1	UTSW	5	136308504	missense	probably damaging	0.99

Predicted Primers

Posted On

2017-05-11