Incidental Mutation 'R2423:Pcdha11'
ID 476244
Institutional Source Beutler Lab
Gene Symbol Pcdha11
Ensembl Gene ENSMUSG00000102206
Gene Name protocadherin alpha 11
Synonyms A830022B16Rik, Cnr7, Crnr7
MMRRC Submission 040385-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R2423 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 37143911-37320710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37140477 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 702 (I702T)
Ref Sequence ENSEMBL: ENSMUSP00000111322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115657] [ENSMUST00000115658] [ENSMUST00000115659] [ENSMUST00000115661] [ENSMUST00000193839] [ENSMUST00000192512] [ENSMUST00000193777] [ENSMUST00000192295] [ENSMUST00000192631] [ENSMUST00000192503] [ENSMUST00000115662] [ENSMUST00000192168] [ENSMUST00000193389] [ENSMUST00000192447] [ENSMUST00000194038] [ENSMUST00000195590] [ENSMUST00000194544] [ENSMUST00000194751]
AlphaFold Q91Y19
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097612
Predicted Effect probably benign
Transcript: ENSMUST00000115657
SMART Domains Protein: ENSMUSP00000111321
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 2.95e-2 SMART
CA 155 240 7.44e-19 SMART
CA 264 347 5.63e-28 SMART
CA 371 452 3.14e-26 SMART
CA 476 562 1.42e-24 SMART
CA 593 675 1.03e-12 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
low complexity region 918 942 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115658
AA Change: I702T

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111322
Gene: ENSMUSG00000007440
AA Change: I702T

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
CA 46 132 6.34e-2 SMART
CA 156 241 4.65e-20 SMART
CA 265 349 1.25e-25 SMART
CA 373 454 9.22e-24 SMART
CA 478 564 4.3e-24 SMART
CA 595 678 5.07e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 795 929 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115659
SMART Domains Protein: ENSMUSP00000111323
Gene: ENSMUSG00000103770

DomainStartEndE-ValueType
low complexity region 44 51 N/A INTRINSIC
CA 75 161 2.46e-2 SMART
CA 185 270 8.1e-20 SMART
CA 294 378 1.69e-22 SMART
CA 402 483 1.52e-24 SMART
CA 507 593 5.68e-24 SMART
CA 624 705 6.69e-12 SMART
transmembrane domain 727 749 N/A INTRINSIC
Pfam:Cadherin_tail 828 962 5.6e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192512
SMART Domains Protein: ENSMUSP00000141408
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
low complexity region 915 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193777
SMART Domains Protein: ENSMUSP00000141587
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000192295
SMART Domains Protein: ENSMUSP00000142103
Gene: ENSMUSG00000104252

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 568 5.38e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192631
SMART Domains Protein: ENSMUSP00000142156
Gene: ENSMUSG00000104318

DomainStartEndE-ValueType
CA 21 131 2.58e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 1.42e-24 SMART
CA 372 453 9.36e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 671 4.03e-6 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 905 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192503
SMART Domains Protein: ENSMUSP00000141989
Gene: ENSMUSG00000102312

DomainStartEndE-ValueType
low complexity region 11 17 N/A INTRINSIC
CA 42 128 3.78e-2 SMART
CA 152 237 8.94e-22 SMART
CA 261 345 3.74e-24 SMART
CA 369 450 1.09e-25 SMART
CA 474 560 1.42e-24 SMART
CA 588 670 2.96e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 910 934 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115662
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192168
SMART Domains Protein: ENSMUSP00000142293
Gene: ENSMUSG00000103092

DomainStartEndE-ValueType
CA 21 131 2.2e-2 SMART
CA 155 240 2.05e-21 SMART
CA 264 348 8.81e-21 SMART
CA 372 453 2.01e-24 SMART
CA 477 563 1.42e-24 SMART
CA 591 673 1.63e-15 SMART
transmembrane domain 693 715 N/A INTRINSIC
low complexity region 902 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193389
SMART Domains Protein: ENSMUSP00000141459
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
CA 21 131 5.67e-2 SMART
CA 155 240 4.72e-21 SMART
CA 264 348 1.9e-25 SMART
CA 372 453 3.31e-25 SMART
CA 477 563 1.42e-24 SMART
CA 594 676 5.91e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192447
SMART Domains Protein: ENSMUSP00000142270
Gene: ENSMUSG00000102206

DomainStartEndE-ValueType
CA 21 131 1.5e-4 SMART
CA 155 240 3.6e-21 SMART
CA 264 347 2.8e-30 SMART
CA 371 452 1.5e-28 SMART
CA 476 562 6.8e-27 SMART
CA 593 675 4.9e-15 SMART
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 783 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194050
Predicted Effect probably benign
Transcript: ENSMUST00000194038
SMART Domains Protein: ENSMUSP00000142159
Gene: ENSMUSG00000103800

DomainStartEndE-ValueType
CA 20 131 6.34e-2 SMART
CA 155 240 4.27e-19 SMART
CA 264 348 2.04e-25 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 9.88e-24 SMART
CA 594 676 8.62e-15 SMART
transmembrane domain 699 721 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194751
SMART Domains Protein: ENSMUSP00000142285
Gene: ENSMUSG00000103707

DomainStartEndE-ValueType
low complexity region 15 21 N/A INTRINSIC
Pfam:Cadherin_2 29 112 4.5e-32 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amer2 T C 14: 60,616,656 (GRCm39) S284P possibly damaging Het
Ap5z1 T C 5: 142,462,532 (GRCm39) V614A probably benign Het
Arhgap9 A T 10: 127,162,993 (GRCm39) probably null Het
Brf1 G A 12: 112,963,819 (GRCm39) A53V probably benign Het
Cyp1a2 C T 9: 57,587,232 (GRCm39) R353Q probably damaging Het
Deup1 G T 9: 15,503,754 (GRCm39) S269* probably null Het
F11r T A 1: 171,289,191 (GRCm39) Y218N possibly damaging Het
Gjd4 G T 18: 9,280,811 (GRCm39) S89* probably null Het
Mapkbp1 A T 2: 119,855,071 (GRCm39) E1430V probably benign Het
Mga A G 2: 119,795,274 (GRCm39) K2986R probably damaging Het
Myo9b G T 8: 71,780,584 (GRCm39) V494L probably damaging Het
Nbea G A 3: 55,992,727 (GRCm39) T293I probably damaging Het
Neto2 C T 8: 86,396,396 (GRCm39) R83Q probably damaging Het
Ocm A T 5: 143,961,388 (GRCm39) probably null Het
Or52z14 C T 7: 103,253,241 (GRCm39) R127C probably benign Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Rbbp8nl A T 2: 179,922,764 (GRCm39) S210T probably damaging Het
Rbl2 A T 8: 91,813,774 (GRCm39) I340F probably benign Het
Rft1 T C 14: 30,388,724 (GRCm39) L216P possibly damaging Het
Slc26a10 T A 10: 127,015,606 (GRCm39) probably null Het
Slc34a1 G A 13: 55,556,865 (GRCm39) A235T possibly damaging Het
Spag17 A G 3: 100,010,772 (GRCm39) T2089A probably benign Het
Srek1 G C 13: 103,889,536 (GRCm39) S260* probably null Het
Sspo T C 6: 48,430,989 (GRCm39) V624A probably benign Het
Tapt1 T C 5: 44,349,795 (GRCm39) I251V probably benign Het
Tmem248 T C 5: 130,258,403 (GRCm39) I32T probably damaging Het
Tnk1 T G 11: 69,746,587 (GRCm39) T209P probably damaging Het
Trip12 TATACATACATACATACATACATACATACATAC TATACATACATACATACATACATACATACATACATAC 1: 84,792,511 (GRCm39) probably null Het
Trp53tg5 T A 2: 164,313,250 (GRCm39) R142* probably null Het
Upf1 C T 8: 70,791,110 (GRCm39) R544H probably damaging Het
Vldlr C T 19: 27,213,688 (GRCm39) T125I possibly damaging Het
Vps8 A G 16: 21,378,087 (GRCm39) T1033A probably benign Het
Wiz A C 17: 32,580,859 (GRCm39) H197Q probably damaging Het
Other mutations in Pcdha11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Pcdha11 APN 18 37,318,061 (GRCm39) missense probably damaging 1.00
IGL01843:Pcdha11 APN 18 37,145,886 (GRCm39) missense probably benign 0.28
R1165:Pcdha11 UTSW 18 37,140,757 (GRCm39) intron probably benign
R2422:Pcdha11 UTSW 18 37,140,325 (GRCm39) missense probably damaging 0.99
R2508:Pcdha11 UTSW 18 37,145,907 (GRCm39) missense possibly damaging 0.86
R3114:Pcdha11 UTSW 18 37,144,860 (GRCm39) missense probably damaging 1.00
R4173:Pcdha11 UTSW 18 37,145,676 (GRCm39) missense probably damaging 0.99
R4255:Pcdha11 UTSW 18 37,145,843 (GRCm39) missense probably benign 0.23
R4369:Pcdha11 UTSW 18 37,139,796 (GRCm39) missense possibly damaging 0.70
R4454:Pcdha11 UTSW 18 37,140,426 (GRCm39) missense probably benign 0.13
R4489:Pcdha11 UTSW 18 37,139,969 (GRCm39) missense possibly damaging 0.78
R4626:Pcdha11 UTSW 18 37,140,051 (GRCm39) missense probably damaging 1.00
R4751:Pcdha11 UTSW 18 37,139,997 (GRCm39) missense probably damaging 1.00
R4801:Pcdha11 UTSW 18 37,138,518 (GRCm39) missense probably damaging 1.00
R4802:Pcdha11 UTSW 18 37,138,518 (GRCm39) missense probably damaging 1.00
R4857:Pcdha11 UTSW 18 37,144,505 (GRCm39) missense probably benign 0.02
R4995:Pcdha11 UTSW 18 37,144,080 (GRCm39) missense probably benign 0.24
R5042:Pcdha11 UTSW 18 37,144,649 (GRCm39) missense probably damaging 1.00
R5480:Pcdha11 UTSW 18 37,138,935 (GRCm39) missense probably benign 0.04
R5495:Pcdha11 UTSW 18 37,144,079 (GRCm39) missense probably benign
R5523:Pcdha11 UTSW 18 37,145,439 (GRCm39) missense probably damaging 1.00
R5584:Pcdha11 UTSW 18 37,139,818 (GRCm39) missense probably damaging 1.00
R5682:Pcdha11 UTSW 18 37,144,502 (GRCm39) missense probably damaging 1.00
R5834:Pcdha11 UTSW 18 37,145,676 (GRCm39) missense probably damaging 0.99
R5842:Pcdha11 UTSW 18 37,144,337 (GRCm39) missense possibly damaging 0.85
R5859:Pcdha11 UTSW 18 37,140,336 (GRCm39) missense probably damaging 1.00
R6110:Pcdha11 UTSW 18 37,144,509 (GRCm39) missense probably damaging 1.00
R6135:Pcdha11 UTSW 18 37,138,870 (GRCm39) missense probably damaging 1.00
R6248:Pcdha11 UTSW 18 37,138,950 (GRCm39) missense probably benign 0.26
R6416:Pcdha11 UTSW 18 37,145,222 (GRCm39) splice site probably null
R6450:Pcdha11 UTSW 18 37,146,215 (GRCm39) missense probably damaging 1.00
R6594:Pcdha11 UTSW 18 37,144,235 (GRCm39) missense probably benign 0.04
R6631:Pcdha11 UTSW 18 37,138,844 (GRCm39) missense probably damaging 1.00
R6883:Pcdha11 UTSW 18 37,144,242 (GRCm39) missense probably damaging 1.00
R7088:Pcdha11 UTSW 18 37,138,470 (GRCm39) missense probably benign 0.00
R7129:Pcdha11 UTSW 18 37,140,291 (GRCm39) missense probably benign 0.45
R7153:Pcdha11 UTSW 18 37,144,278 (GRCm39) missense probably damaging 1.00
R7244:Pcdha11 UTSW 18 37,144,421 (GRCm39) nonsense probably null
R7295:Pcdha11 UTSW 18 37,139,979 (GRCm39) missense probably damaging 1.00
R7319:Pcdha11 UTSW 18 37,146,245 (GRCm39) missense probably benign 0.10
R7352:Pcdha11 UTSW 18 37,139,898 (GRCm39) missense probably damaging 1.00
R7516:Pcdha11 UTSW 18 37,144,671 (GRCm39) missense probably damaging 1.00
R7519:Pcdha11 UTSW 18 37,139,319 (GRCm39) nonsense probably null
R7660:Pcdha11 UTSW 18 37,138,904 (GRCm39) missense probably benign 0.17
R7677:Pcdha11 UTSW 18 37,144,605 (GRCm39) missense probably damaging 1.00
R7707:Pcdha11 UTSW 18 37,144,845 (GRCm39) missense probably benign 0.00
R7775:Pcdha11 UTSW 18 37,145,733 (GRCm39) missense possibly damaging 0.64
R7778:Pcdha11 UTSW 18 37,145,733 (GRCm39) missense possibly damaging 0.64
R7780:Pcdha11 UTSW 18 37,145,849 (GRCm39) missense probably damaging 0.97
R7916:Pcdha11 UTSW 18 37,140,441 (GRCm39) missense probably benign 0.01
R7991:Pcdha11 UTSW 18 37,145,909 (GRCm39) missense probably damaging 0.99
R8068:Pcdha11 UTSW 18 37,138,618 (GRCm39) missense probably damaging 1.00
R8220:Pcdha11 UTSW 18 37,139,624 (GRCm39) missense probably benign 0.01
R8252:Pcdha11 UTSW 18 37,140,590 (GRCm39) missense possibly damaging 0.65
R8392:Pcdha11 UTSW 18 37,139,212 (GRCm39) nonsense probably null
R8398:Pcdha11 UTSW 18 37,146,116 (GRCm39) missense possibly damaging 0.65
R8470:Pcdha11 UTSW 18 37,145,937 (GRCm39) missense probably benign 0.07
R8812:Pcdha11 UTSW 18 37,140,716 (GRCm39) missense probably benign 0.00
R8900:Pcdha11 UTSW 18 37,145,799 (GRCm39) missense probably damaging 1.00
R8968:Pcdha11 UTSW 18 37,145,307 (GRCm39) missense probably damaging 1.00
R9065:Pcdha11 UTSW 18 37,139,877 (GRCm39) missense possibly damaging 0.93
R9192:Pcdha11 UTSW 18 37,140,527 (GRCm39) missense probably benign 0.42
R9224:Pcdha11 UTSW 18 37,139,073 (GRCm39) missense probably damaging 0.99
R9228:Pcdha11 UTSW 18 37,144,512 (GRCm39) missense probably damaging 1.00
R9237:Pcdha11 UTSW 18 37,145,260 (GRCm39) missense probably damaging 1.00
R9336:Pcdha11 UTSW 18 37,144,514 (GRCm39) missense probably damaging 1.00
R9449:Pcdha11 UTSW 18 37,145,484 (GRCm39) missense probably damaging 1.00
R9475:Pcdha11 UTSW 18 37,140,591 (GRCm39) missense probably damaging 1.00
R9476:Pcdha11 UTSW 18 37,139,532 (GRCm39) missense probably benign 0.26
R9510:Pcdha11 UTSW 18 37,139,532 (GRCm39) missense probably benign 0.26
R9578:Pcdha11 UTSW 18 37,140,176 (GRCm39) missense probably damaging 1.00
R9654:Pcdha11 UTSW 18 37,145,333 (GRCm39) missense probably damaging 1.00
RF017:Pcdha11 UTSW 18 37,138,577 (GRCm39) missense possibly damaging 0.92
Z1177:Pcdha11 UTSW 18 37,145,976 (GRCm39) missense probably benign 0.43
Predicted Primers
Posted On 2017-05-11