Incidental Mutation 'R0506:Myom1'
ID47626
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0506 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 71092220 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
Predicted Effect probably benign
Transcript: ENSMUST00000024847
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073211
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180743
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 intron probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 intron probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACCACAGCATTAGGGGAGAACTTACAT -3'
(R):5'- TGTTAACTACTCAGACAGCACCTACAGA -3'

Sequencing Primer
(F):5'- ctccccaacccacccac -3'
(R):5'- TCAGACAGCACCTACAGAGAATG -3'
Posted On2013-06-12