Incidental Mutation 'R0506:Trappc8'
ID 47628
Institutional Source Beutler Lab
Gene Symbol Trappc8
Ensembl Gene ENSMUSG00000033382
Gene Name trafficking protein particle complex 8
Synonyms 5033403J15Rik, D030074E01Rik, Trs85
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 20950280-21029150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20977245 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 841 (N841K)
Ref Sequence ENSEMBL: ENSMUSP00000153183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025177] [ENSMUST00000097658] [ENSMUST00000225661]
AlphaFold A0A286YCX6
Predicted Effect probably benign
Transcript: ENSMUST00000025177
AA Change: N842K

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000025177
Gene: ENSMUSG00000033382
AA Change: N842K

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 157 604 1e-167 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097658
SMART Domains Protein: ENSMUSP00000095262
Gene: ENSMUSG00000033382

DomainStartEndE-ValueType
Pfam:TRAPPC-Trs85 152 605 9.3e-135 PFAM
low complexity region 769 777 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223584
Predicted Effect possibly damaging
Transcript: ENSMUST00000225661
AA Change: N841K

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Trappc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Trappc8 APN 18 20,970,035 (GRCm39) missense probably benign 0.20
IGL01367:Trappc8 APN 18 20,999,176 (GRCm39) missense probably benign 0.01
IGL01537:Trappc8 APN 18 20,968,061 (GRCm39) missense probably benign
IGL01563:Trappc8 APN 18 20,970,103 (GRCm39) missense probably benign 0.00
IGL01982:Trappc8 APN 18 21,007,769 (GRCm39) splice site probably benign
IGL02709:Trappc8 APN 18 20,970,235 (GRCm39) missense possibly damaging 0.94
IGL03126:Trappc8 APN 18 20,996,652 (GRCm39) missense probably damaging 1.00
IGL03290:Trappc8 APN 18 20,953,992 (GRCm39) missense probably damaging 1.00
IGL03348:Trappc8 APN 18 20,985,838 (GRCm39) missense probably damaging 1.00
hoppa UTSW 18 20,969,957 (GRCm39) missense probably benign 0.05
Lagomorpha UTSW 18 20,951,247 (GRCm39) missense probably benign 0.11
rabbit UTSW 18 21,007,737 (GRCm39) missense probably damaging 1.00
E7848:Trappc8 UTSW 18 20,983,975 (GRCm39) missense probably damaging 0.99
R0483:Trappc8 UTSW 18 20,978,658 (GRCm39) missense possibly damaging 0.60
R0492:Trappc8 UTSW 18 20,999,243 (GRCm39) missense probably benign 0.07
R0610:Trappc8 UTSW 18 20,970,245 (GRCm39) missense probably damaging 1.00
R0892:Trappc8 UTSW 18 20,964,665 (GRCm39) critical splice donor site probably null
R1561:Trappc8 UTSW 18 20,974,680 (GRCm39) nonsense probably null
R1589:Trappc8 UTSW 18 20,996,608 (GRCm39) missense probably damaging 1.00
R1700:Trappc8 UTSW 18 20,966,055 (GRCm39) missense probably damaging 1.00
R1785:Trappc8 UTSW 18 20,967,997 (GRCm39) splice site probably null
R1786:Trappc8 UTSW 18 20,967,997 (GRCm39) splice site probably null
R1989:Trappc8 UTSW 18 20,978,708 (GRCm39) missense probably benign 0.04
R2181:Trappc8 UTSW 18 20,952,279 (GRCm39) critical splice donor site probably null
R2294:Trappc8 UTSW 18 20,999,211 (GRCm39) nonsense probably null
R4551:Trappc8 UTSW 18 21,007,729 (GRCm39) missense probably benign 0.10
R4594:Trappc8 UTSW 18 20,970,005 (GRCm39) missense probably benign
R4631:Trappc8 UTSW 18 21,000,865 (GRCm39) missense probably benign 0.22
R4734:Trappc8 UTSW 18 20,974,629 (GRCm39) nonsense probably null
R4834:Trappc8 UTSW 18 20,958,122 (GRCm39) missense probably damaging 0.99
R5114:Trappc8 UTSW 18 20,977,237 (GRCm39) missense probably benign 0.04
R5262:Trappc8 UTSW 18 20,951,247 (GRCm39) missense probably benign 0.11
R5384:Trappc8 UTSW 18 20,966,119 (GRCm39) splice site probably null
R5476:Trappc8 UTSW 18 20,998,165 (GRCm39) missense probably damaging 1.00
R5503:Trappc8 UTSW 18 20,969,957 (GRCm39) missense probably benign 0.05
R5577:Trappc8 UTSW 18 20,969,836 (GRCm39) nonsense probably null
R5809:Trappc8 UTSW 18 20,951,139 (GRCm39) missense probably benign 0.08
R5825:Trappc8 UTSW 18 21,006,977 (GRCm39) missense probably damaging 1.00
R5886:Trappc8 UTSW 18 21,007,737 (GRCm39) missense probably damaging 1.00
R5936:Trappc8 UTSW 18 21,007,745 (GRCm39) missense probably damaging 1.00
R6024:Trappc8 UTSW 18 20,966,066 (GRCm39) missense probably damaging 0.98
R6105:Trappc8 UTSW 18 20,979,504 (GRCm39) critical splice donor site probably null
R6229:Trappc8 UTSW 18 21,003,802 (GRCm39) missense probably benign 0.00
R6376:Trappc8 UTSW 18 20,970,132 (GRCm39) missense probably benign 0.07
R6403:Trappc8 UTSW 18 20,999,128 (GRCm39) missense probably benign
R6459:Trappc8 UTSW 18 20,969,925 (GRCm39) missense probably benign 0.40
R6673:Trappc8 UTSW 18 21,018,314 (GRCm39) missense probably benign 0.01
R7041:Trappc8 UTSW 18 21,007,729 (GRCm39) missense probably benign 0.10
R7276:Trappc8 UTSW 18 20,951,148 (GRCm39) missense probably damaging 0.99
R7341:Trappc8 UTSW 18 20,985,704 (GRCm39) missense probably damaging 1.00
R7684:Trappc8 UTSW 18 20,996,559 (GRCm39) missense probably benign 0.01
R7702:Trappc8 UTSW 18 20,958,119 (GRCm39) missense probably damaging 0.99
R8210:Trappc8 UTSW 18 21,006,938 (GRCm39) critical splice donor site probably null
R8958:Trappc8 UTSW 18 21,003,667 (GRCm39) missense probably benign 0.02
R9037:Trappc8 UTSW 18 20,961,539 (GRCm39) missense probably benign 0.00
R9217:Trappc8 UTSW 18 21,000,822 (GRCm39) missense probably benign 0.01
R9246:Trappc8 UTSW 18 20,993,590 (GRCm39) missense possibly damaging 0.64
R9623:Trappc8 UTSW 18 20,983,975 (GRCm39) missense possibly damaging 0.91
R9766:Trappc8 UTSW 18 20,979,630 (GRCm39) missense possibly damaging 0.68
X0065:Trappc8 UTSW 18 20,993,579 (GRCm39) missense probably benign 0.03
Z1177:Trappc8 UTSW 18 20,964,720 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATATGCTTACACATGCTTAGCTGCC -3'
(R):5'- CCATTGCACTTGGGATTTGCTGAC -3'

Sequencing Primer
(F):5'- gtggatgacaacataacatggg -3'
(R):5'- aaaaaaaaaaaggaaggaaggaagg -3'
Posted On 2013-06-12