Incidental Mutation 'R0506:Myo7b'
ID 47629
Institutional Source Beutler Lab
Gene Symbol Myo7b
Ensembl Gene ENSMUSG00000024388
Gene Name myosin VIIB
Synonyms
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0506 (G1)
Quality Score 156
Status Validated
Chromosome 18
Chromosomal Location 32092287-32169984 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 32097439 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000134663]
AlphaFold Q99MZ6
Predicted Effect probably null
Transcript: ENSMUST00000134663
SMART Domains Protein: ENSMUSP00000118046
Gene: ENSMUSG00000024388

DomainStartEndE-ValueType
MYSc 59 761 N/A SMART
IQ 762 784 1.07e-1 SMART
IQ 785 807 7.01e-6 SMART
IQ 831 853 4.93e-1 SMART
IQ 854 876 1.63e-1 SMART
MyTH4 989 1189 1.14e-71 SMART
B41 1190 1409 3.66e-16 SMART
SH3 1501 1563 3.25e-7 SMART
MyTH4 1641 1790 7.66e-55 SMART
B41 1792 2009 8.19e-28 SMART
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in brush border microvilli of epithelial cells in the intestines and kidneys. The encoded protein is involved in linking protocadherins to the actin cytoskeleton and is essential for proper microvilli function. This protein aids in the accumulation of intermicrovillar adhesion components such as harmonin and ANKS4B, and this accumulation is necessary for normal brush border action. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or10w1 T A 19: 13,632,261 (GRCm39) I151N possibly damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Myo7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Myo7b APN 18 32,154,609 (GRCm39) utr 5 prime probably benign
IGL01799:Myo7b APN 18 32,095,823 (GRCm39) missense probably damaging 1.00
IGL01881:Myo7b APN 18 32,133,320 (GRCm39) splice site probably benign
IGL01883:Myo7b APN 18 32,131,204 (GRCm39) missense probably damaging 1.00
IGL01934:Myo7b APN 18 32,134,394 (GRCm39) critical splice donor site probably null
IGL01980:Myo7b APN 18 32,094,953 (GRCm39) missense possibly damaging 0.86
IGL02506:Myo7b APN 18 32,100,207 (GRCm39) missense probably damaging 1.00
IGL02704:Myo7b APN 18 32,100,014 (GRCm39) missense probably benign 0.13
IGL02929:Myo7b APN 18 32,127,978 (GRCm39) missense probably benign 0.19
IGL03149:Myo7b APN 18 32,147,355 (GRCm39) missense probably damaging 1.00
IGL03335:Myo7b APN 18 32,118,073 (GRCm39) missense possibly damaging 0.81
IGL03372:Myo7b APN 18 32,131,654 (GRCm39) missense probably damaging 1.00
IGL03385:Myo7b APN 18 32,122,630 (GRCm39) missense probably benign 0.00
PIT4131001:Myo7b UTSW 18 32,094,259 (GRCm39) missense probably benign 0.17
PIT4445001:Myo7b UTSW 18 32,095,405 (GRCm39) missense probably damaging 0.96
PIT4445001:Myo7b UTSW 18 32,092,519 (GRCm39) missense possibly damaging 0.80
R0034:Myo7b UTSW 18 32,093,913 (GRCm39) missense probably damaging 1.00
R0138:Myo7b UTSW 18 32,143,204 (GRCm39) missense probably damaging 1.00
R0149:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0226:Myo7b UTSW 18 32,105,949 (GRCm39) missense probably benign 0.00
R0312:Myo7b UTSW 18 32,147,390 (GRCm39) missense possibly damaging 0.68
R0361:Myo7b UTSW 18 32,147,262 (GRCm39) missense probably damaging 1.00
R0524:Myo7b UTSW 18 32,146,477 (GRCm39) missense possibly damaging 0.91
R0645:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R0724:Myo7b UTSW 18 32,138,602 (GRCm39) splice site probably benign
R0731:Myo7b UTSW 18 32,094,878 (GRCm39) splice site probably null
R0762:Myo7b UTSW 18 32,116,997 (GRCm39) missense probably benign 0.01
R0843:Myo7b UTSW 18 32,107,137 (GRCm39) missense possibly damaging 0.83
R0894:Myo7b UTSW 18 32,133,123 (GRCm39) missense probably damaging 1.00
R0966:Myo7b UTSW 18 32,131,816 (GRCm39) missense probably damaging 1.00
R1205:Myo7b UTSW 18 32,127,395 (GRCm39) missense probably damaging 1.00
R1387:Myo7b UTSW 18 32,116,805 (GRCm39) splice site probably benign
R1523:Myo7b UTSW 18 32,099,929 (GRCm39) missense probably damaging 1.00
R1544:Myo7b UTSW 18 32,127,962 (GRCm39) missense probably benign 0.10
R1623:Myo7b UTSW 18 32,133,104 (GRCm39) missense probably damaging 1.00
R1780:Myo7b UTSW 18 32,094,238 (GRCm39) missense probably damaging 1.00
R1785:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1786:Myo7b UTSW 18 32,127,950 (GRCm39) missense probably benign
R1796:Myo7b UTSW 18 32,119,728 (GRCm39) missense possibly damaging 0.93
R1907:Myo7b UTSW 18 32,110,052 (GRCm39) missense possibly damaging 0.89
R2027:Myo7b UTSW 18 32,118,013 (GRCm39) missense probably benign
R2102:Myo7b UTSW 18 32,133,031 (GRCm39) missense probably damaging 1.00
R2174:Myo7b UTSW 18 32,116,610 (GRCm39) missense probably damaging 1.00
R2272:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably benign 0.41
R2323:Myo7b UTSW 18 32,104,398 (GRCm39) missense probably damaging 1.00
R2365:Myo7b UTSW 18 32,147,384 (GRCm39) missense probably damaging 0.98
R3078:Myo7b UTSW 18 32,100,237 (GRCm39) missense probably benign 0.04
R3522:Myo7b UTSW 18 32,143,132 (GRCm39) missense probably damaging 1.00
R3788:Myo7b UTSW 18 32,107,165 (GRCm39) missense possibly damaging 0.95
R3880:Myo7b UTSW 18 32,102,567 (GRCm39) missense probably damaging 0.96
R4334:Myo7b UTSW 18 32,110,040 (GRCm39) missense probably damaging 1.00
R4343:Myo7b UTSW 18 32,116,680 (GRCm39) missense probably damaging 1.00
R4497:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4498:Myo7b UTSW 18 32,147,282 (GRCm39) missense probably benign 0.06
R4551:Myo7b UTSW 18 32,118,161 (GRCm39) missense probably benign 0.01
R4593:Myo7b UTSW 18 32,146,428 (GRCm39) missense possibly damaging 0.77
R4616:Myo7b UTSW 18 32,136,540 (GRCm39) splice site probably null
R4646:Myo7b UTSW 18 32,127,422 (GRCm39) missense probably benign 0.25
R4648:Myo7b UTSW 18 32,100,178 (GRCm39) splice site probably null
R4737:Myo7b UTSW 18 32,131,655 (GRCm39) missense probably damaging 1.00
R4765:Myo7b UTSW 18 32,094,953 (GRCm39) missense probably benign 0.00
R4790:Myo7b UTSW 18 32,133,158 (GRCm39) splice site probably null
R4909:Myo7b UTSW 18 32,097,489 (GRCm39) missense probably benign 0.01
R5027:Myo7b UTSW 18 32,108,265 (GRCm39) missense probably benign 0.22
R5034:Myo7b UTSW 18 32,104,440 (GRCm39) missense probably damaging 1.00
R5112:Myo7b UTSW 18 32,116,640 (GRCm39) missense probably damaging 1.00
R5266:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5267:Myo7b UTSW 18 32,131,787 (GRCm39) missense probably damaging 1.00
R5348:Myo7b UTSW 18 32,116,972 (GRCm39) missense probably damaging 0.96
R5457:Myo7b UTSW 18 32,104,503 (GRCm39) splice site probably null
R5540:Myo7b UTSW 18 32,140,143 (GRCm39) missense probably damaging 1.00
R5628:Myo7b UTSW 18 32,107,240 (GRCm39) missense probably benign
R5815:Myo7b UTSW 18 32,099,341 (GRCm39) missense probably damaging 1.00
R6062:Myo7b UTSW 18 32,101,043 (GRCm39) missense possibly damaging 0.94
R6137:Myo7b UTSW 18 32,133,027 (GRCm39) missense probably damaging 1.00
R6158:Myo7b UTSW 18 32,121,602 (GRCm39) missense probably benign 0.00
R6218:Myo7b UTSW 18 32,092,507 (GRCm39) missense probably benign 0.10
R6256:Myo7b UTSW 18 32,116,748 (GRCm39) missense probably damaging 1.00
R6257:Myo7b UTSW 18 32,146,468 (GRCm39) missense probably damaging 1.00
R6265:Myo7b UTSW 18 32,131,203 (GRCm39) missense probably damaging 1.00
R6302:Myo7b UTSW 18 32,127,439 (GRCm39) missense probably damaging 0.98
R6438:Myo7b UTSW 18 32,099,382 (GRCm39) missense probably damaging 1.00
R6654:Myo7b UTSW 18 32,123,322 (GRCm39) missense possibly damaging 0.46
R7030:Myo7b UTSW 18 32,104,626 (GRCm39) missense probably damaging 1.00
R7090:Myo7b UTSW 18 32,131,765 (GRCm39) missense probably damaging 1.00
R7210:Myo7b UTSW 18 32,140,155 (GRCm39) missense probably damaging 1.00
R7218:Myo7b UTSW 18 32,114,054 (GRCm39) missense probably benign 0.05
R7378:Myo7b UTSW 18 32,099,292 (GRCm39) missense probably damaging 1.00
R7458:Myo7b UTSW 18 32,121,604 (GRCm39) missense possibly damaging 0.89
R7517:Myo7b UTSW 18 32,146,320 (GRCm39) missense probably damaging 0.99
R7559:Myo7b UTSW 18 32,116,413 (GRCm39) missense probably benign 0.01
R7667:Myo7b UTSW 18 32,094,958 (GRCm39) missense probably benign
R7737:Myo7b UTSW 18 32,147,257 (GRCm39) nonsense probably null
R7942:Myo7b UTSW 18 32,146,422 (GRCm39) missense probably damaging 0.98
R8030:Myo7b UTSW 18 32,131,135 (GRCm39) missense probably damaging 0.96
R8114:Myo7b UTSW 18 32,098,677 (GRCm39) missense probably damaging 1.00
R8338:Myo7b UTSW 18 32,104,408 (GRCm39) missense probably damaging 0.96
R8341:Myo7b UTSW 18 32,116,979 (GRCm39) missense probably benign 0.39
R8406:Myo7b UTSW 18 32,092,866 (GRCm39) missense probably damaging 1.00
R8464:Myo7b UTSW 18 32,095,757 (GRCm39) missense probably benign 0.00
R8517:Myo7b UTSW 18 32,100,244 (GRCm39) missense possibly damaging 0.87
R8537:Myo7b UTSW 18 32,110,142 (GRCm39) missense probably benign 0.08
R8546:Myo7b UTSW 18 32,123,201 (GRCm39) missense probably benign 0.19
R8721:Myo7b UTSW 18 32,140,064 (GRCm39) missense probably damaging 1.00
R8770:Myo7b UTSW 18 32,114,124 (GRCm39) missense probably benign 0.03
R8841:Myo7b UTSW 18 32,097,490 (GRCm39) missense probably benign 0.06
R8853:Myo7b UTSW 18 32,119,744 (GRCm39) missense possibly damaging 0.67
R8960:Myo7b UTSW 18 32,127,299 (GRCm39) splice site probably benign
R8984:Myo7b UTSW 18 32,099,402 (GRCm39) missense probably null 0.68
R9356:Myo7b UTSW 18 32,110,096 (GRCm39) missense probably damaging 1.00
R9357:Myo7b UTSW 18 32,093,129 (GRCm39) missense probably damaging 1.00
R9364:Myo7b UTSW 18 32,133,413 (GRCm39) missense probably benign 0.12
R9405:Myo7b UTSW 18 32,109,356 (GRCm39) missense probably benign 0.00
R9533:Myo7b UTSW 18 32,108,297 (GRCm39) missense probably benign 0.27
R9776:Myo7b UTSW 18 32,133,068 (GRCm39) missense probably benign 0.45
X0027:Myo7b UTSW 18 32,098,689 (GRCm39) missense probably damaging 1.00
Z1176:Myo7b UTSW 18 32,114,051 (GRCm39) missense possibly damaging 0.82
Z1177:Myo7b UTSW 18 32,118,109 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCCTTAACTTGGTGCAGCG -3'
(R):5'- TCCATAGTGTCACAGCCAGCAGTC -3'

Sequencing Primer
(F):5'- CCCTGACACTGGCTTGTAG -3'
(R):5'- AGCTGAATCTCCCATTAAGGCTG -3'
Posted On 2013-06-12