Incidental Mutation 'R0506:Or10w1'
ID 47633
Institutional Source Beutler Lab
Gene Symbol Or10w1
Ensembl Gene ENSMUSG00000061387
Gene Name olfactory receptor family 10 subfamily W member 1
Synonyms Olfr1490, GA_x6K02T2RE5P-3987000-3987950, MOR266-6P
MMRRC Submission 038701-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R0506 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13631810-13632760 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 13632261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 151 (I151N)
Ref Sequence ENSEMBL: ENSMUSP00000079057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080162] [ENSMUST00000208667] [ENSMUST00000213900]
AlphaFold A0A1L1SVH0
Predicted Effect possibly damaging
Transcript: ENSMUST00000080162
AA Change: I151N

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000079057
Gene: ENSMUSG00000061387
AA Change: I151N

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.3e-48 PFAM
Pfam:7tm_1 41 290 2e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208667
AA Change: I156N
Predicted Effect possibly damaging
Transcript: ENSMUST00000213900
AA Change: I156N

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216631
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,137,319 (GRCm39) C378* probably null Het
Ago3 T C 4: 126,311,045 (GRCm39) D56G possibly damaging Het
Ahnak G T 19: 8,986,492 (GRCm39) G2592V probably damaging Het
Aldh6a1 C T 12: 84,480,300 (GRCm39) G470D probably damaging Het
Ankub1 T A 3: 57,597,796 (GRCm39) N58I probably damaging Het
Apol7b G T 15: 77,309,728 (GRCm39) T23K probably benign Het
Arap2 G A 5: 62,763,474 (GRCm39) P1557S possibly damaging Het
Arhgap24 T C 5: 103,023,643 (GRCm39) Y136H probably damaging Het
Atp1a1 A G 3: 101,497,128 (GRCm39) F393L probably damaging Het
Bcdin3d A T 15: 99,368,873 (GRCm39) C109S probably damaging Het
Catsperd A G 17: 56,965,078 (GRCm39) K475R possibly damaging Het
Cblb A G 16: 52,024,843 (GRCm39) T913A probably benign Het
Cbx6 A G 15: 79,712,404 (GRCm39) L341P probably benign Het
Cd177 T C 7: 24,457,781 (GRCm39) Y159C probably damaging Het
Cdh20 A G 1: 110,027,844 (GRCm39) N530D probably damaging Het
Cdk8 T C 5: 146,235,682 (GRCm39) F270L probably damaging Het
Ces2c A T 8: 105,574,656 (GRCm39) T38S probably damaging Het
Chst14 T C 2: 118,758,202 (GRCm39) L357P probably damaging Het
Clca3b T A 3: 144,528,627 (GRCm39) probably benign Het
Cluh A G 11: 74,555,720 (GRCm39) S839G probably benign Het
Cnga4 T A 7: 105,056,947 (GRCm39) V350E probably damaging Het
Creb1 G A 1: 64,609,426 (GRCm39) G180R probably damaging Het
Csmd3 T C 15: 48,320,907 (GRCm39) E301G probably benign Het
Cyp4f18 A T 8: 72,749,844 (GRCm39) D268E probably benign Het
Dock5 A G 14: 68,022,241 (GRCm39) probably benign Het
Dpy19l4 T A 4: 11,289,715 (GRCm39) H332L probably benign Het
Dync2h1 T A 9: 7,113,153 (GRCm39) H224L probably benign Het
Dzip1l C A 9: 99,545,134 (GRCm39) Q585K possibly damaging Het
Erf C T 7: 24,943,801 (GRCm39) G510D probably damaging Het
Fanci T C 7: 79,081,926 (GRCm39) L623P probably benign Het
Fat1 T C 8: 45,475,988 (GRCm39) V1655A probably damaging Het
Fat4 T C 3: 38,942,463 (GRCm39) V452A probably benign Het
Gal3st4 C T 5: 138,264,151 (GRCm39) G283S probably benign Het
Gm5422 A G 10: 31,126,318 (GRCm39) noncoding transcript Het
Gnal C T 18: 67,221,744 (GRCm39) T49I unknown Het
Gng5 A G 3: 146,209,103 (GRCm39) N57S probably damaging Het
Herc1 A G 9: 66,355,441 (GRCm39) I2231V probably damaging Het
Hgfac G T 5: 35,201,584 (GRCm39) G272W probably damaging Het
Hmcn1 T A 1: 150,618,092 (GRCm39) D1265V possibly damaging Het
Ifi207 T A 1: 173,563,878 (GRCm39) Q47L possibly damaging Het
Klhl40 G A 9: 121,607,133 (GRCm39) E98K probably damaging Het
Lepr G T 4: 101,630,207 (GRCm39) probably benign Het
Lyst A G 13: 13,812,600 (GRCm39) H1004R probably benign Het
Map3k1 T A 13: 111,892,298 (GRCm39) R986* probably null Het
Mmp1b C A 9: 7,387,013 (GRCm39) Q66H possibly damaging Het
Mpo T C 11: 87,694,330 (GRCm39) S107P probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Myo7b A G 18: 32,097,439 (GRCm39) probably null Het
Myom1 T C 17: 71,399,215 (GRCm39) probably benign Het
Nalcn C T 14: 123,834,026 (GRCm39) V50I possibly damaging Het
Negr1 A G 3: 156,866,385 (GRCm39) probably benign Het
Nlrc5 T G 8: 95,219,753 (GRCm39) probably benign Het
Nyap2 G A 1: 81,065,029 (GRCm39) D14N probably damaging Het
Or2h1 C A 17: 37,404,203 (GRCm39) G188W probably damaging Het
Or5b105 G A 19: 13,080,642 (GRCm39) R3C possibly damaging Het
Parp14 A T 16: 35,661,779 (GRCm39) S1419T possibly damaging Het
Piezo2 A G 18: 63,160,615 (GRCm39) F2347S probably damaging Het
Pigf A G 17: 87,316,337 (GRCm39) V147A probably benign Het
Pkhd1 A T 1: 20,629,693 (GRCm39) M637K probably benign Het
Plce1 T C 19: 38,748,582 (GRCm39) I1771T probably benign Het
Ppp6c A T 2: 39,096,660 (GRCm39) probably benign Het
Prag1 T C 8: 36,570,854 (GRCm39) V479A possibly damaging Het
Prss33 A T 17: 24,054,079 (GRCm39) D42E probably benign Het
Psmb10 A G 8: 106,664,177 (GRCm39) V64A possibly damaging Het
Psmd14 A G 2: 61,630,407 (GRCm39) T306A probably benign Het
Psmg1 C T 16: 95,790,687 (GRCm39) probably benign Het
Rc3h2 A T 2: 37,266,671 (GRCm39) probably null Het
Reln C T 5: 22,125,494 (GRCm39) V2730I probably damaging Het
Sec24a A T 11: 51,634,622 (GRCm39) H101Q probably benign Het
Selenoi A G 5: 30,471,954 (GRCm39) N385S probably benign Het
Slc24a4 T C 12: 102,097,882 (GRCm39) probably null Het
Slc4a10 G A 2: 62,080,877 (GRCm39) S338N probably benign Het
Slfn3 A T 11: 83,103,986 (GRCm39) T286S probably damaging Het
Snx29 A G 16: 11,213,167 (GRCm39) D111G probably benign Het
Sp8 T C 12: 118,812,300 (GRCm39) S52P possibly damaging Het
Srek1 G T 13: 103,897,098 (GRCm39) T81K probably damaging Het
Sry C G Y: 2,662,864 (GRCm39) Q265H unknown Het
Taf3 A G 2: 9,945,804 (GRCm39) V600A probably benign Het
Tatdn2 C A 6: 113,679,550 (GRCm39) D298E probably benign Het
Tmem253 A T 14: 52,254,663 (GRCm39) probably benign Het
Tmem63a T A 1: 180,785,614 (GRCm39) probably null Het
Tmprss11b T C 5: 86,809,499 (GRCm39) D331G probably damaging Het
Tor1aip1 T A 1: 155,883,420 (GRCm39) K143* probably null Het
Trappc8 A T 18: 20,977,245 (GRCm39) N841K possibly damaging Het
Trio T C 15: 27,855,049 (GRCm39) Q711R probably benign Het
Trmt10b C A 4: 45,304,306 (GRCm39) T114N probably damaging Het
Trpv2 C A 11: 62,473,732 (GRCm39) A129D probably benign Het
Ttll4 T G 1: 74,727,777 (GRCm39) D846E probably benign Het
Ugt2a3 A G 5: 87,484,508 (GRCm39) L172P possibly damaging Het
Usp19 T A 9: 108,371,686 (GRCm39) F355Y probably damaging Het
Vmn1r209 C T 13: 22,990,114 (GRCm39) G192D probably damaging Het
Vmn2r107 T G 17: 20,578,021 (GRCm39) D443E probably benign Het
Wee2 A T 6: 40,440,187 (GRCm39) E445V probably benign Het
Zer1 A T 2: 29,991,819 (GRCm39) I680N probably damaging Het
Zfhx4 T C 3: 5,467,795 (GRCm39) L2651P probably damaging Het
Zfp692 C T 11: 58,199,881 (GRCm39) Q157* probably null Het
Zfp964 T A 8: 70,116,587 (GRCm39) C396S unknown Het
Other mutations in Or10w1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Or10w1 APN 19 13,632,297 (GRCm39) missense probably damaging 0.96
IGL01335:Or10w1 APN 19 13,632,540 (GRCm39) missense probably damaging 1.00
IGL01561:Or10w1 APN 19 13,632,269 (GRCm39) missense probably benign
IGL01644:Or10w1 APN 19 13,632,768 (GRCm39) utr 3 prime probably benign
IGL02257:Or10w1 APN 19 13,632,629 (GRCm39) missense probably benign
IGL02282:Or10w1 APN 19 13,632,622 (GRCm39) missense probably damaging 1.00
IGL02355:Or10w1 APN 19 13,632,597 (GRCm39) missense probably benign 0.02
IGL02362:Or10w1 APN 19 13,632,597 (GRCm39) missense probably benign 0.02
IGL02639:Or10w1 APN 19 13,631,960 (GRCm39) missense possibly damaging 0.73
R0078:Or10w1 UTSW 19 13,632,179 (GRCm39) missense probably benign 0.00
R0278:Or10w1 UTSW 19 13,632,129 (GRCm39) missense probably damaging 1.00
R0278:Or10w1 UTSW 19 13,632,128 (GRCm39) missense probably damaging 1.00
R0927:Or10w1 UTSW 19 13,631,816 (GRCm39) missense probably damaging 0.99
R1087:Or10w1 UTSW 19 13,632,376 (GRCm39) nonsense probably null
R1762:Or10w1 UTSW 19 13,631,868 (GRCm39) missense probably benign
R2901:Or10w1 UTSW 19 13,632,309 (GRCm39) missense probably damaging 1.00
R2907:Or10w1 UTSW 19 13,632,611 (GRCm39) missense possibly damaging 0.84
R3625:Or10w1 UTSW 19 13,632,346 (GRCm39) nonsense probably null
R3838:Or10w1 UTSW 19 13,632,321 (GRCm39) missense probably benign 0.00
R4745:Or10w1 UTSW 19 13,632,750 (GRCm39) missense probably benign
R4804:Or10w1 UTSW 19 13,631,882 (GRCm39) missense probably benign
R5026:Or10w1 UTSW 19 13,632,296 (GRCm39) missense probably benign 0.03
R5314:Or10w1 UTSW 19 13,632,630 (GRCm39) missense probably benign 0.08
R6052:Or10w1 UTSW 19 13,631,871 (GRCm39) missense possibly damaging 0.95
R6235:Or10w1 UTSW 19 13,632,145 (GRCm39) nonsense probably null
R7405:Or10w1 UTSW 19 13,632,246 (GRCm39) missense probably benign 0.14
R7557:Or10w1 UTSW 19 13,632,390 (GRCm39) missense possibly damaging 0.71
R8038:Or10w1 UTSW 19 13,632,719 (GRCm39) missense possibly damaging 0.91
R8338:Or10w1 UTSW 19 13,632,216 (GRCm39) missense possibly damaging 0.92
R8366:Or10w1 UTSW 19 13,631,903 (GRCm39) missense probably damaging 1.00
R8496:Or10w1 UTSW 19 13,632,388 (GRCm39) missense probably damaging 0.96
R8783:Or10w1 UTSW 19 13,632,323 (GRCm39) missense probably damaging 1.00
R8838:Or10w1 UTSW 19 13,632,371 (GRCm39) missense probably damaging 0.98
R8859:Or10w1 UTSW 19 13,632,246 (GRCm39) missense probably damaging 0.99
R9064:Or10w1 UTSW 19 13,632,719 (GRCm39) missense possibly damaging 0.91
R9161:Or10w1 UTSW 19 13,632,038 (GRCm39) missense probably damaging 1.00
R9466:Or10w1 UTSW 19 13,631,796 (GRCm39) start codon destroyed probably null
R9596:Or10w1 UTSW 19 13,632,002 (GRCm39) missense probably damaging 1.00
R9623:Or10w1 UTSW 19 13,632,414 (GRCm39) missense probably damaging 1.00
Z1176:Or10w1 UTSW 19 13,631,827 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGACCATTTCTCTGCTGAGCTGTG -3'
(R):5'- AGAACAAGTGTTGAAGGCCCTGTG -3'

Sequencing Primer
(F):5'- TGAGCTGTGCCACTCAGATG -3'
(R):5'- AGTTTGAGCACAGCAGCC -3'
Posted On 2013-06-12