Incidental Mutation 'R0507:Zfp512b'
ID47648
Institutional Source Beutler Lab
Gene Symbol Zfp512b
Ensembl Gene ENSMUSG00000000823
Gene Namezinc finger protein 512B
SynonymsLOC269401, Znf512b
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181582103-181592803 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 181584964 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000057816] [ENSMUST00000108789] [ENSMUST00000128553] [ENSMUST00000129469] [ENSMUST00000131949] [ENSMUST00000140103]
Predicted Effect probably benign
Transcript: ENSMUST00000057816
SMART Domains Protein: ENSMUSP00000050398
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 249 7e-10 PFAM
Pfam:PRK 100 288 5.7e-61 PFAM
Pfam:UPRTase 326 532 2.6e-74 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000108789
AA Change: R823L
SMART Domains Protein: ENSMUSP00000104417
Gene: ENSMUSG00000000823
AA Change: R823L

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
ZnF_C2H2 106 128 5.83e1 SMART
ZnF_C2H2 141 164 3.89e-3 SMART
internal_repeat_1 168 224 4.38e-14 PROSPERO
internal_repeat_1 246 302 4.38e-14 PROSPERO
ZnF_C2H2 487 511 5.68e1 SMART
ZnF_C2H2 517 540 2.91e-2 SMART
low complexity region 547 560 N/A INTRINSIC
ZnF_C2H2 571 593 1.59e1 SMART
ZnF_C2H2 607 630 4.4e-2 SMART
Blast:ZnF_C2H2 727 756 8e-11 BLAST
ZnF_C2H2 761 784 1.45e-2 SMART
low complexity region 808 832 N/A INTRINSIC
low complexity region 838 856 N/A INTRINSIC
low complexity region 858 866 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123110
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126672
Predicted Effect unknown
Transcript: ENSMUST00000128553
AA Change: R833L
SMART Domains Protein: ENSMUSP00000115601
Gene: ENSMUSG00000000823
AA Change: R833L

DomainStartEndE-ValueType
ZnF_C2H2 85 107 5.83e1 SMART
low complexity region 111 124 N/A INTRINSIC
low complexity region 130 140 N/A INTRINSIC
ZnF_C2H2 151 174 3.89e-3 SMART
internal_repeat_1 178 234 1.6e-14 PROSPERO
internal_repeat_1 256 312 1.6e-14 PROSPERO
ZnF_C2H2 497 521 5.68e1 SMART
ZnF_C2H2 527 550 2.91e-2 SMART
low complexity region 557 570 N/A INTRINSIC
ZnF_C2H2 581 603 1.59e1 SMART
ZnF_C2H2 617 640 4.4e-2 SMART
internal_repeat_2 723 761 4.94e-7 PROSPERO
ZnF_C2H2 771 794 1.45e-2 SMART
low complexity region 818 842 N/A INTRINSIC
low complexity region 848 866 N/A INTRINSIC
low complexity region 868 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129469
SMART Domains Protein: ENSMUSP00000121607
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:CPT 98 210 5.1e-10 PFAM
Pfam:AAA_17 100 251 1.1e-8 PFAM
Pfam:PRK 100 288 3.4e-60 PFAM
Pfam:AAA_18 101 257 5.8e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131866
Predicted Effect probably benign
Transcript: ENSMUST00000131949
Predicted Effect probably benign
Transcript: ENSMUST00000132538
SMART Domains Protein: ENSMUSP00000119677
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 46 70 5.68e1 SMART
ZnF_C2H2 76 99 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135561
SMART Domains Protein: ENSMUSP00000121721
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
ZnF_C2H2 12 35 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136759
Predicted Effect probably benign
Transcript: ENSMUST00000140103
SMART Domains Protein: ENSMUSP00000123579
Gene: ENSMUSG00000000823

DomainStartEndE-ValueType
Blast:ZnF_C2H2 2 24 8e-7 BLAST
ZnF_C2H2 29 52 1.45e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144856
SMART Domains Protein: ENSMUSP00000114982
Gene: ENSMUSG00000089917

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
Pfam:CPT 83 211 2.7e-10 PFAM
Pfam:PRK 85 253 7.7e-56 PFAM
Pfam:AAA_17 86 240 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183624
Meta Mutation Damage Score 0.1519 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Other mutations in Zfp512b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp512b APN 2 181587069 missense probably damaging 0.98
IGL00667:Zfp512b APN 2 181589733 missense probably damaging 0.97
IGL00763:Zfp512b APN 2 181590151 missense probably damaging 1.00
IGL01448:Zfp512b APN 2 181587785 missense possibly damaging 0.62
IGL01788:Zfp512b APN 2 181588763 missense possibly damaging 0.86
IGL02048:Zfp512b APN 2 181589922 missense possibly damaging 0.77
IGL02752:Zfp512b APN 2 181588071 missense possibly damaging 0.46
IGL03238:Zfp512b APN 2 181589760 missense probably damaging 1.00
R0421:Zfp512b UTSW 2 181588258 nonsense probably null
R0713:Zfp512b UTSW 2 181588300 missense possibly damaging 0.79
R1074:Zfp512b UTSW 2 181589179 missense probably damaging 0.96
R1513:Zfp512b UTSW 2 181589189 missense probably benign 0.00
R1560:Zfp512b UTSW 2 181588679 missense probably benign 0.00
R1595:Zfp512b UTSW 2 181588436 missense probably damaging 1.00
R1673:Zfp512b UTSW 2 181588493 missense possibly damaging 0.61
R1845:Zfp512b UTSW 2 181585735 missense probably damaging 1.00
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1888:Zfp512b UTSW 2 181588442 missense probably damaging 0.99
R1943:Zfp512b UTSW 2 181588415 missense probably damaging 1.00
R1975:Zfp512b UTSW 2 181587085 nonsense probably null
R2520:Zfp512b UTSW 2 181589502 missense probably damaging 1.00
R3876:Zfp512b UTSW 2 181588763 frame shift probably null
R3877:Zfp512b UTSW 2 181588763 frame shift probably null
R4171:Zfp512b UTSW 2 181590598 unclassified probably null
R4607:Zfp512b UTSW 2 181588774 missense probably damaging 1.00
R4732:Zfp512b UTSW 2 181588739 missense probably benign
R4733:Zfp512b UTSW 2 181588739 missense probably benign
R4766:Zfp512b UTSW 2 181585095 unclassified probably benign
R4888:Zfp512b UTSW 2 181587063 missense probably damaging 1.00
R4965:Zfp512b UTSW 2 181586338 missense probably damaging 1.00
R5632:Zfp512b UTSW 2 181585668 missense probably benign 0.27
R6897:Zfp512b UTSW 2 181590480 missense probably damaging 1.00
R6970:Zfp512b UTSW 2 181586348 missense possibly damaging 0.92
R7432:Zfp512b UTSW 2 181589856 missense probably benign
R7560:Zfp512b UTSW 2 181587082 missense probably damaging 1.00
R8045:Zfp512b UTSW 2 181584824 makesense not run
Predicted Primers PCR Primer
(F):5'- GAGAGCAGAGTAGTTTGCCAACCC -3'
(R):5'- GAACACACATGCAGTCATGAATGCC -3'

Sequencing Primer
(F):5'- GGCTCCCCTAATCTGGACAATG -3'
(R):5'- TGCAGTCATGAATGCCAAGAAAAC -3'
Posted On2013-06-12