Incidental Mutation 'R0507:Ppp1r13l'
ID47658
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19375814 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 720 (L720P)
Ref Sequence ENSEMBL: ENSMUSP00000047839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047621
AA Change: L720P

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734
AA Change: L720P

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Meta Mutation Damage Score 0.1785 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4063:Ppp1r13l UTSW 7 19370053 missense probably benign
R4685:Ppp1r13l UTSW 7 19375383 critical splice donor site probably null
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6171:Ppp1r13l UTSW 7 19377511 missense probably benign 0.06
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
R7367:Ppp1r13l UTSW 7 19370156 missense probably benign 0.36
R7381:Ppp1r13l UTSW 7 19368861 critical splice donor site probably null
R7467:Ppp1r13l UTSW 7 19371380 missense probably damaging 0.99
R7510:Ppp1r13l UTSW 7 19368801 missense possibly damaging 0.52
R8185:Ppp1r13l UTSW 7 19372938 missense probably benign 0.00
RF015:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
RF022:Ppp1r13l UTSW 7 19368542 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTGGCTCAGAAGTAGGATGGTG -3'
(R):5'- GCATAGCTACAAGTGTTCCAGCCTC -3'

Sequencing Primer
(F):5'- AGAAGTAGGATGGTGCTGCTG -3'
(R):5'- AAGTGTTCCAGCCTCTAAGTAGC -3'
Posted On2013-06-12