Mutagenetix > Incidental Mutations

Incidental Mutation 'R0507:Csmd1'

47662

Institutional Source

Beutler Lab

Gene Symbol

Csmd1

Ensembl Gene

ENSMUSG00000060924

Gene Name

CUB and Sushi multiple domains 1

Synonyms

MMRRC Submission

038702-MU

Accession Numbers

Genbank: NM_053171.2

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0507 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

15892537-17535586 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 16185344 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000080751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082104]

Predicted Effect

probably benign
Transcript: ENSMUST00000082104

SMART Domains

Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CUB	32	140	1.46e-26	SMART
CCP	145	202	1.01e-11	SMART
CUB	208	312	1.05e-27	SMART
CCP	349	406	1.28e-8	SMART
CUB	411	522	2.34e-25	SMART
CCP	527	580	1.22e-14	SMART
CUB	584	692	1.61e-37	SMART
CCP	697	754	4.41e-12	SMART
CUB	758	866	6.55e-38	SMART
CCP	873	926	2.53e-12	SMART
CUB	930	1040	8.94e-22	SMART
CCP	1045	1100	7.06e-11	SMART
CUB	1104	1212	3.14e-26	SMART
CCP	1217	1273	1.18e-12	SMART
CUB	1277	1386	9.72e-32	SMART
CCP	1391	1447	2.06e-12	SMART
CUB	1451	1559	1.68e-35	SMART
CCP	1564	1621	2.53e-12	SMART
CUB	1625	1733	4.24e-14	SMART
CCP	1741	1798	9.46e-12	SMART
CUB	1802	1910	4.23e-32	SMART
CCP	1915	1970	8.23e-12	SMART
CUB	1974	2082	8.59e-33	SMART
CCP	2087	2142	6.09e-15	SMART
CUB	2146	2253	2.36e-30	SMART
CCP	2258	2315	1.1e-12	SMART
CUB	2320	2430	4.3e-24	SMART
CCP	2432	2490	2.94e-8	SMART
CCP	2495	2552	2.03e-11	SMART
CCP	2557	2617	1.22e-5	SMART
CCP	2622	2675	2.72e-12	SMART
CCP	2680	2733	5.86e-17	SMART
CCP	2738	2791	6.09e-15	SMART
CCP	2796	2854	9.1e-14	SMART
CCP	2859	2912	3.96e-14	SMART
CCP	2920	2973	4.41e-12	SMART
CCP	2978	3032	2.94e-8	SMART
CCP	3037	3092	6.59e-11	SMART
CCP	3097	3150	4.12e-12	SMART
CCP	3155	3208	7.92e-14	SMART
CCP	3216	3270	2.8e-14	SMART
CCP	3275	3330	3.78e-11	SMART
transmembrane domain	3487	3509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131778

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	T	C	8: 105,284,719	N261S	probably damaging	Het
Abca7	T	A	10: 80,002,821		probably benign	Het
Adamts16	T	C	13: 70,768,647	D742G	probably benign	Het
Akap9	G	A	5: 4,069,043	E3517K	probably benign	Het
Arfgef3	T	C	10: 18,591,621	T1944A	probably damaging	Het
Bsx	A	G	9: 40,876,500		probably benign	Het
Cct2	A	T	10: 117,055,246		probably null	Het
Cdkl4	T	C	17: 80,543,808	D155G	probably benign	Het
Cep250	C	T	2: 155,992,532	R2126C	possibly damaging	Het
Cep97	A	T	16: 55,905,882		probably benign	Het
Cpne3	C	T	4: 19,532,544		probably benign	Het
Cx3cr1	C	A	9: 120,051,956	D127Y	probably damaging	Het
Dcdc2a	A	G	13: 25,102,589	Q165R	probably damaging	Het
Ddx17	A	G	15: 79,537,557		probably benign	Het
Dicer1	A	G	12: 104,691,658	S1886P	probably damaging	Het
Egf	T	C	3: 129,681,179	D571G	possibly damaging	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gbp2	G	T	3: 142,630,033	D165Y	probably damaging	Het
Gm14124	T	A	2: 150,268,124	C245S	possibly damaging	Het
Gm14412	A	T	2: 177,314,532	N523K	possibly damaging	Het
Gsap	C	T	5: 21,269,963	T540I	possibly damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Icam4	C	A	9: 21,029,503	P17Q	possibly damaging	Het
Lyz1	A	T	10: 117,289,117		probably null	Het
Mbd6	A	G	10: 127,283,520		probably benign	Het
Mroh3	A	T	1: 136,190,980	I533N	probably damaging	Het
Muc4	A	T	16: 32,751,069	M316L	probably benign	Het
Myof	A	G	19: 37,901,277	I1282T	possibly damaging	Het
Ncald	T	G	15: 37,397,284	I51L	probably benign	Het
Negr1	T	A	3: 156,562,225	S11T	probably damaging	Het
Obscn	T	C	11: 59,029,341	N6735D	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1500	T	A	19: 13,827,776	I207F	possibly damaging	Het
Olfr503	T	C	7: 108,545,085	S185P	probably damaging	Het
Olfr786	A	T	10: 129,437,288	M159L	probably benign	Het
Otogl	A	G	10: 107,866,740	V684A	possibly damaging	Het
Palm3	A	G	8: 84,028,329	T157A	probably benign	Het
Pard3	T	A	8: 127,371,486		probably benign	Het
Pcdh15	A	G	10: 74,621,297	D1302G	probably damaging	Het
Pi16	G	A	17: 29,327,852	E467K	possibly damaging	Het
Plec	A	T	15: 76,172,783	I4183N	probably damaging	Het
Ppp1r13l	T	C	7: 19,375,814	L720P	possibly damaging	Het
Prag1	A	G	8: 36,104,123	E620G	probably damaging	Het
Ralbp1	G	A	17: 65,849,960	T646M	probably benign	Het
Rnf182	T	G	13: 43,668,347	S125A	probably benign	Het
Rpe	C	T	1: 66,715,141	T124I	probably benign	Het
Rufy4	T	C	1: 74,146,716	I514T	probably benign	Het
Sec13	A	T	6: 113,735,119	I85N	probably damaging	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Skint5	T	C	4: 113,567,930		probably null	Het
Slc4a3	T	A	1: 75,556,081	I995K	probably damaging	Het
Smyd4	T	A	11: 75,399,708	S545T	possibly damaging	Het
Steap3	C	T	1: 120,241,583	R328H	possibly damaging	Het
Tgm6	G	A	2: 130,138,831	E183K	possibly damaging	Het
Themis	T	A	10: 28,781,832	V132E	possibly damaging	Het
Thsd1	T	A	8: 22,258,679	I461N	probably damaging	Het
Ttk	T	G	9: 83,868,067	S692A	probably damaging	Het
Twf1	A	G	15: 94,585,530	M99T	probably damaging	Het
Uchl3	T	A	14: 101,667,007	L89*	probably null	Het
Uhmk1	A	G	1: 170,207,191	V316A	probably damaging	Het
Unc80	A	G	1: 66,527,893	N886S	possibly damaging	Het
Vash2	G	T	1: 190,966,918		probably benign	Het
Vmn1r200	G	A	13: 22,395,548	E174K	probably benign	Het
Vps16	T	C	2: 130,437,712		probably null	Het
Wdr73	T	C	7: 80,891,846	E316G	possibly damaging	Het
Xpo1	T	C	11: 23,294,682	V1020A	possibly damaging	Het
Ylpm1	T	A	12: 85,029,112	N870K	probably benign	Het
Zfhx4	C	T	3: 5,400,988	Q2069*	probably null	Het
Zfp512b	C	A	2: 181,584,964		probably benign	Het

Other mutations in Csmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Csmd1	APN	8	16009297	splice site	probably benign
IGL00433:Csmd1	APN	8	16231373	missense	probably damaging	1.00
IGL00500:Csmd1	APN	8	15921139	missense	probably damaging	1.00
IGL00666:Csmd1	APN	8	16189990	missense	probably damaging	1.00
IGL00913:Csmd1	APN	8	16071287	missense	probably benign	0.00
IGL01012:Csmd1	APN	8	15917341	missense	probably benign	0.00
IGL01123:Csmd1	APN	8	17534928	missense	possibly damaging	0.96
IGL01348:Csmd1	APN	8	15910596	missense	probably damaging	0.99
IGL01444:Csmd1	APN	8	16200055	missense	probably benign	0.00
IGL01530:Csmd1	APN	8	15903195	missense	probably damaging	0.99
IGL01548:Csmd1	APN	8	16288646	nonsense	probably null
IGL01814:Csmd1	APN	8	16501375	missense	probably damaging	1.00
IGL01889:Csmd1	APN	8	15998857	missense	probably damaging	1.00
IGL02055:Csmd1	APN	8	16069001	missense	probably damaging	0.99
IGL02066:Csmd1	APN	8	15926594	missense	probably damaging	1.00
IGL02097:Csmd1	APN	8	16211759	missense	probably null	0.17
IGL02112:Csmd1	APN	8	16081705	missense	probably benign	0.18
IGL02161:Csmd1	APN	8	16358412	missense	probably damaging	0.97
IGL02189:Csmd1	APN	8	16271606	missense	probably damaging	0.99
IGL02272:Csmd1	APN	8	16199893	missense	probably damaging	0.99
IGL02292:Csmd1	APN	8	16211870	missense	probably damaging	1.00
IGL02385:Csmd1	APN	8	15903275	missense	probably benign	0.08
IGL02424:Csmd1	APN	8	16092326	missense	probably benign	0.22
IGL02492:Csmd1	APN	8	16002597	missense	probably benign	0.13
IGL02507:Csmd1	APN	8	17534976	utr 5 prime	probably benign
IGL02513:Csmd1	APN	8	15999869	splice site	probably benign
IGL02727:Csmd1	APN	8	16231327	missense	probably damaging	1.00
IGL02728:Csmd1	APN	8	15999779	critical splice donor site	probably null
IGL02852:Csmd1	APN	8	15895728	missense	probably damaging	0.99
IGL02935:Csmd1	APN	8	16223334	missense	probably damaging	1.00
IGL02945:Csmd1	APN	8	16271570	missense	possibly damaging	0.92
IGL02959:Csmd1	APN	8	15910465	missense	probably damaging	0.99
IGL03113:Csmd1	APN	8	16028698	missense	probably benign
IGL03129:Csmd1	APN	8	15961521	missense	probably damaging	0.99
IGL03131:Csmd1	APN	8	16088217	missense	probably damaging	1.00
IGL03275:Csmd1	APN	8	16157092	missense	probably benign	0.00
IGL03297:Csmd1	APN	8	16009432	nonsense	probably null
ikura	UTSW	8	16231271	missense	probably damaging	1.00
I2289:Csmd1	UTSW	8	15912381	missense	probably benign	0.10
IGL03055:Csmd1	UTSW	8	16095501	missense	probably damaging	1.00
IGL03097:Csmd1	UTSW	8	15945127	missense	probably damaging	1.00
PIT4260001:Csmd1	UTSW	8	16070313	missense	probably damaging	1.00
PIT4378001:Csmd1	UTSW	8	15895728	missense	probably damaging	0.99
PIT4520001:Csmd1	UTSW	8	15906023	missense	probably benign	0.01
R0037:Csmd1	UTSW	8	15917248	missense	probably damaging	0.97
R0095:Csmd1	UTSW	8	16233051	missense	probably damaging	1.00
R0113:Csmd1	UTSW	8	15984849	missense	probably damaging	1.00
R0129:Csmd1	UTSW	8	16079942	missense	possibly damaging	0.95
R0144:Csmd1	UTSW	8	16391824	missense	probably benign	0.16
R0166:Csmd1	UTSW	8	16233022	missense	probably benign	0.29
R0227:Csmd1	UTSW	8	16391822	missense	probably benign	0.05
R0279:Csmd1	UTSW	8	16223235	missense	probably damaging	0.99
R0280:Csmd1	UTSW	8	16271602	missense	probably damaging	1.00
R0312:Csmd1	UTSW	8	15984760	missense	probably damaging	1.00
R0355:Csmd1	UTSW	8	15918330	missense	probably damaging	0.97
R0367:Csmd1	UTSW	8	15917270	missense	probably damaging	1.00
R0395:Csmd1	UTSW	8	16346638	missense	probably damaging	0.99
R0413:Csmd1	UTSW	8	16710514	missense	probably damaging	0.97
R0457:Csmd1	UTSW	8	16501393	critical splice acceptor site	probably null
R0463:Csmd1	UTSW	8	15921759	missense	probably damaging	0.99
R0482:Csmd1	UTSW	8	16233101	missense	probably damaging	1.00
R0501:Csmd1	UTSW	8	17027323	missense	probably damaging	0.97
R0505:Csmd1	UTSW	8	15992758	missense	probably damaging	1.00
R0511:Csmd1	UTSW	8	15932529	missense	possibly damaging	0.80
R0555:Csmd1	UTSW	8	16185273	missense	probably benign
R0580:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R0610:Csmd1	UTSW	8	15918208	missense	possibly damaging	0.95
R0634:Csmd1	UTSW	8	16226391	missense	probably damaging	1.00
R0666:Csmd1	UTSW	8	16069049	missense	possibly damaging	0.88
R0674:Csmd1	UTSW	8	16000550	missense	probably benign	0.03
R0675:Csmd1	UTSW	8	16158131	missense	probably benign	0.01
R0763:Csmd1	UTSW	8	17027284	missense	possibly damaging	0.67
R0781:Csmd1	UTSW	8	15921174	missense	probably benign	0.35
R0862:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0864:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0925:Csmd1	UTSW	8	16710618	missense	probably benign	0.29
R0926:Csmd1	UTSW	8	16033576	splice site	probably null
R1005:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R1073:Csmd1	UTSW	8	16358463	splice site	probably benign
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1256:Csmd1	UTSW	8	16079964	missense	probably damaging	1.00
R1294:Csmd1	UTSW	8	16698036	missense	probably damaging	0.99
R1375:Csmd1	UTSW	8	16463081	splice site	probably null
R1447:Csmd1	UTSW	8	15925306	nonsense	probably null
R1450:Csmd1	UTSW	8	15945180	critical splice acceptor site	probably null
R1470:Csmd1	UTSW	8	16157204	splice site	probably benign
R1580:Csmd1	UTSW	8	15925299	missense	probably damaging	1.00
R1591:Csmd1	UTSW	8	15900710	missense	probably damaging	0.99
R1658:Csmd1	UTSW	8	16081725	missense	possibly damaging	0.69
R1678:Csmd1	UTSW	8	15918252	missense	possibly damaging	0.58
R1717:Csmd1	UTSW	8	17216692	missense	possibly damaging	0.58
R1735:Csmd1	UTSW	8	15932610	missense	probably damaging	0.99
R1750:Csmd1	UTSW	8	15917303	missense	probably damaging	0.99
R1753:Csmd1	UTSW	8	16157120	nonsense	probably null
R1822:Csmd1	UTSW	8	16223326	missense	probably damaging	1.00
R1875:Csmd1	UTSW	8	15929101	missense	probably damaging	0.99
R1909:Csmd1	UTSW	8	15906116	missense	probably damaging	1.00
R1912:Csmd1	UTSW	8	16233998	critical splice donor site	probably null
R1993:Csmd1	UTSW	8	16346684	missense	probably damaging	0.99
R2067:Csmd1	UTSW	8	15900782	missense	probably benign
R2094:Csmd1	UTSW	8	16079978	missense	probably damaging	0.99
R2119:Csmd1	UTSW	8	17216733	missense	probably damaging	0.98
R2127:Csmd1	UTSW	8	15917392	missense	probably damaging	1.00
R2138:Csmd1	UTSW	8	15929088	missense	probably damaging	0.96
R2216:Csmd1	UTSW	8	17027339	critical splice acceptor site	probably null
R2220:Csmd1	UTSW	8	15992641	missense	possibly damaging	0.94
R2380:Csmd1	UTSW	8	16190087	missense	probably damaging	1.00
R2471:Csmd1	UTSW	8	16211762	missense	probably damaging	1.00
R2984:Csmd1	UTSW	8	15953782	missense	probably damaging	1.00
R3001:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3002:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3003:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3103:Csmd1	UTSW	8	15917405	missense	probably damaging	1.00
R3104:Csmd1	UTSW	8	17027231	missense	probably damaging	1.00
R3620:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3621:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3748:Csmd1	UTSW	8	15906071	missense	probably damaging	0.99
R3780:Csmd1	UTSW	8	16201986	missense	probably damaging	1.00
R3815:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3816:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3818:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3819:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3850:Csmd1	UTSW	8	16079922	missense	probably benign	0.00
R3945:Csmd1	UTSW	8	15910619	splice site	probably null
R3980:Csmd1	UTSW	8	15906056	nonsense	probably null
R4061:Csmd1	UTSW	8	15945158	missense	probably benign	0.00
R4086:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4087:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4089:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4183:Csmd1	UTSW	8	15910464	missense	probably damaging	0.99
R4226:Csmd1	UTSW	8	16000490	missense	probably damaging	0.99
R4454:Csmd1	UTSW	8	15945011	missense	probably damaging	0.99
R4533:Csmd1	UTSW	8	15931037	splice site	probably null
R4544:Csmd1	UTSW	8	16710636	missense	possibly damaging	0.93
R4547:Csmd1	UTSW	8	16391797	missense	possibly damaging	0.48
R4612:Csmd1	UTSW	8	15921908	splice site	probably null
R4620:Csmd1	UTSW	8	16002694	critical splice acceptor site	probably null
R4627:Csmd1	UTSW	8	16697917	missense	probably benign	0.00
R4633:Csmd1	UTSW	8	16002620	missense	probably damaging	0.99
R4646:Csmd1	UTSW	8	15932511	missense	possibly damaging	0.87
R4648:Csmd1	UTSW	8	15998788	nonsense	probably null
R4668:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.50
R4709:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.96
R4709:Csmd1	UTSW	8	16710506	critical splice donor site	probably null
R4741:Csmd1	UTSW	8	15910447	missense	probably damaging	0.99
R4774:Csmd1	UTSW	8	16009369	missense	probably benign	0.11
R4793:Csmd1	UTSW	8	16088263	missense	probably damaging	1.00
R4829:Csmd1	UTSW	8	16127296	missense	probably damaging	1.00
R4888:Csmd1	UTSW	8	15895674	utr 3 prime	probably benign
R4896:Csmd1	UTSW	8	16009439	missense	probably benign	0.00
R4932:Csmd1	UTSW	8	16023765	missense	probably damaging	0.99
R4944:Csmd1	UTSW	8	15998772	missense	probably damaging	1.00
R4953:Csmd1	UTSW	8	16199917	missense	probably damaging	0.99
R4996:Csmd1	UTSW	8	15910452	missense	probably damaging	0.97
R5028:Csmd1	UTSW	8	15989090	missense	probably damaging	1.00
R5146:Csmd1	UTSW	8	16196190	missense	probably damaging	1.00
R5272:Csmd1	UTSW	8	16199944	missense	probably damaging	0.99
R5327:Csmd1	UTSW	8	17216712	missense	possibly damaging	0.94
R5399:Csmd1	UTSW	8	16710597	missense	probably damaging	1.00
R5411:Csmd1	UTSW	8	15910471	missense	probably damaging	1.00
R5462:Csmd1	UTSW	8	15961486	missense	probably benign	0.12
R5463:Csmd1	UTSW	8	15984860	missense	probably benign	0.34
R5497:Csmd1	UTSW	8	16085181	missense	probably benign	0.20
R5536:Csmd1	UTSW	8	16288660	missense	probably damaging	0.99
R5711:Csmd1	UTSW	8	15953703	missense	probably damaging	1.00
R5730:Csmd1	UTSW	8	16185192	nonsense	probably null
R5788:Csmd1	UTSW	8	16201966	missense	probably damaging	1.00
R5941:Csmd1	UTSW	8	15932471	missense	probably damaging	0.99
R5960:Csmd1	UTSW	8	16071416	missense	possibly damaging	0.68
R5961:Csmd1	UTSW	8	16070352	missense	probably damaging	0.99
R5969:Csmd1	UTSW	8	16071353	missense	probably benign	0.00
R5998:Csmd1	UTSW	8	15910443	missense	probably damaging	1.00
R6062:Csmd1	UTSW	8	16092305	missense	possibly damaging	0.68
R6109:Csmd1	UTSW	8	16199860	missense	possibly damaging	0.93
R6116:Csmd1	UTSW	8	16211850	missense	probably damaging	1.00
R6143:Csmd1	UTSW	8	16088301	missense	probably damaging	1.00
R6155:Csmd1	UTSW	8	15903231	missense	probably benign	0.01
R6197:Csmd1	UTSW	8	15926611	missense	probably benign	0.32
R6247:Csmd1	UTSW	8	16196235	missense	possibly damaging	0.91
R6304:Csmd1	UTSW	8	16058674	missense	probably damaging	1.00
R6317:Csmd1	UTSW	8	16710642	missense	possibly damaging	0.89
R6318:Csmd1	UTSW	8	15903212	missense	probably damaging	1.00
R6338:Csmd1	UTSW	8	15932492	missense	possibly damaging	0.75
R6369:Csmd1	UTSW	8	17535004	start gained	probably benign
R6447:Csmd1	UTSW	8	15910527	missense	probably damaging	1.00
R6454:Csmd1	UTSW	8	15921150	missense	probably damaging	0.99
R6494:Csmd1	UTSW	8	16211695	splice site	probably null
R6614:Csmd1	UTSW	8	17216787	missense	probably damaging	1.00
R6736:Csmd1	UTSW	8	16002626	missense	probably damaging	0.99
R6769:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6771:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6804:Csmd1	UTSW	8	16037246	missense	probably damaging	1.00
R6818:Csmd1	UTSW	8	16185327	missense	probably damaging	1.00
R6863:Csmd1	UTSW	8	17534913	missense	possibly damaging	0.85
R6930:Csmd1	UTSW	8	16092395	missense	probably damaging	0.97
R6969:Csmd1	UTSW	8	17216789	missense	possibly damaging	0.94
R7112:Csmd1	UTSW	8	16101128	missense	probably damaging	1.00
R7124:Csmd1	UTSW	8	15903202	missense	probably damaging	1.00
R7167:Csmd1	UTSW	8	15926524	missense	probably benign
R7243:Csmd1	UTSW	8	15915357	missense	probably damaging	1.00
R7260:Csmd1	UTSW	8	16000574	missense	probably damaging	1.00
R7271:Csmd1	UTSW	8	17027279	missense	probably damaging	0.99
R7324:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7325:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7327:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7373:Csmd1	UTSW	8	15992713	missense	probably damaging	1.00
R7406:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R7427:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7428:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7445:Csmd1	UTSW	8	16158254	missense	possibly damaging	0.61
R7458:Csmd1	UTSW	8	15953738	missense	probably damaging	1.00
R7476:Csmd1	UTSW	8	15895731	missense	probably damaging	1.00
R7527:Csmd1	UTSW	8	16211718	missense	probably damaging	1.00
R7544:Csmd1	UTSW	8	16092296	missense	probably damaging	1.00
R7583:Csmd1	UTSW	8	15998833	missense	probably damaging	0.96
R7603:Csmd1	UTSW	8	16288682	missense	probably damaging	1.00
R7607:Csmd1	UTSW	8	15918331	missense	possibly damaging	0.94
R7642:Csmd1	UTSW	8	16085178	missense	probably damaging	0.99
R7669:Csmd1	UTSW	8	15917273	missense	probably damaging	1.00
R7720:Csmd1	UTSW	8	15931108	missense	probably damaging	1.00
R7728:Csmd1	UTSW	8	16231271	missense	probably damaging	1.00
R7738:Csmd1	UTSW	8	16100990	missense	probably damaging	1.00
R7745:Csmd1	UTSW	8	15932461	critical splice donor site	probably null
R7879:Csmd1	UTSW	8	16391806	missense	probably benign	0.28
R7884:Csmd1	UTSW	8	15961418	missense	probably damaging	1.00
R7897:Csmd1	UTSW	8	17534919	missense	possibly damaging	0.96
R8111:Csmd1	UTSW	8	15917306	missense	probably benign
R8119:Csmd1	UTSW	8	17027294	missense	probably damaging	0.99
R8134:Csmd1	UTSW	8	15932550	missense	probably damaging	0.99
R8187:Csmd1	UTSW	8	16127174	missense	probably damaging	0.99
R8196:Csmd1	UTSW	8	16009468	missense	probably benign	0.18
R8231:Csmd1	UTSW	8	16697923	missense	possibly damaging	0.82
R8242:Csmd1	UTSW	8	16710654	missense	probably benign	0.42
R8274:Csmd1	UTSW	8	15910453	missense	possibly damaging	0.93
R8286:Csmd1	UTSW	8	15989188	missense	probably benign	0.18
R8289:Csmd1	UTSW	8	16058702	missense	probably damaging	0.99
R8314:Csmd1	UTSW	8	16158244	missense	probably benign
R8323:Csmd1	UTSW	8	17216735	nonsense	probably null
R8387:Csmd1	UTSW	8	16000484	missense	possibly damaging	0.94
R8413:Csmd1	UTSW	8	15900676	missense	probably damaging	0.98
X0011:Csmd1	UTSW	8	16196263	missense	probably damaging	1.00
X0021:Csmd1	UTSW	8	16185256	missense	probably damaging	1.00
X0024:Csmd1	UTSW	8	16037218	missense	probably damaging	0.99
X0028:Csmd1	UTSW	8	15915333	missense	possibly damaging	0.79
Z1088:Csmd1	UTSW	8	15921875	missense	possibly damaging	0.91
Z1088:Csmd1	UTSW	8	16092258	missense	probably damaging	1.00
Z1088:Csmd1	UTSW	8	16189978	missense	possibly damaging	0.50
Z1088:Csmd1	UTSW	8	16200058	missense	probably damaging	0.97
Z1088:Csmd1	UTSW	8	16346617	missense	probably damaging	0.99
Z1176:Csmd1	UTSW	8	15998814	missense	probably damaging	1.00
Z1176:Csmd1	UTSW	8	16037198	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	15984708	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	16200019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAACGAAGACCTCTGTTACTTCCTGC -3'
(R):5'- CACACTCCGTGTGACCAGAATATCC -3'

Sequencing Primer
(F):5'- ATTCACTGTAAGGCGAGGTC -3'
(R):5'- GTCATACTTTGACAGAAAGAGTGCC -3'

Posted On

2013-06-12