Incidental Mutation 'R0507:Thsd1'
ID47663
Institutional Source Beutler Lab
Gene Symbol Thsd1
Ensembl Gene ENSMUSG00000031480
Gene Namethrombospondin, type I, domain 1
SynonymsTmtsp, 4833423O18Rik
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location22227313-22261334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22258679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 461 (I461N)
Ref Sequence ENSEMBL: ENSMUSP00000148214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069828] [ENSMUST00000160585] [ENSMUST00000162447]
Predicted Effect probably damaging
Transcript: ENSMUST00000069828
AA Change: I522N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067701
Gene: ENSMUSG00000031480
AA Change: I522N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 342 392 4.55e-8 SMART
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160585
AA Change: I469N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125118
Gene: ENSMUSG00000031480
AA Change: I469N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 343 355 N/A INTRINSIC
transmembrane domain 360 382 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162447
AA Change: I461N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a type 1 thrombospondin domain, which is found in a number of proteins involved in the complement pathway, as well as in extracellular matrix proteins. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Thsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Thsd1 APN 8 22252231 missense probably damaging 1.00
IGL02288:Thsd1 APN 8 22259549 missense probably damaging 1.00
IGL02517:Thsd1 APN 8 22243438 missense probably damaging 1.00
IGL02591:Thsd1 APN 8 22258727 missense probably damaging 1.00
IGL03378:Thsd1 APN 8 22243778 missense probably benign 0.13
R0137:Thsd1 UTSW 8 22243039 missense probably damaging 1.00
R0854:Thsd1 UTSW 8 22258571 missense probably damaging 0.99
R1109:Thsd1 UTSW 8 22243692 missense possibly damaging 0.93
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1402:Thsd1 UTSW 8 22259368 missense possibly damaging 0.68
R1899:Thsd1 UTSW 8 22252318 splice site probably benign
R1900:Thsd1 UTSW 8 22252318 splice site probably benign
R2008:Thsd1 UTSW 8 22259231 missense probably benign 0.23
R2048:Thsd1 UTSW 8 22259317 missense probably benign 0.01
R2090:Thsd1 UTSW 8 22259657 missense possibly damaging 0.95
R2165:Thsd1 UTSW 8 22238522 intron probably benign
R2209:Thsd1 UTSW 8 22258871 missense probably damaging 1.00
R3831:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3833:Thsd1 UTSW 8 22243116 missense possibly damaging 0.92
R3847:Thsd1 UTSW 8 22259411 missense probably damaging 0.97
R4049:Thsd1 UTSW 8 22243164 missense possibly damaging 0.75
R4454:Thsd1 UTSW 8 22243578 missense probably damaging 1.00
R4659:Thsd1 UTSW 8 22259298 nonsense probably null
R4997:Thsd1 UTSW 8 22243324 missense probably damaging 0.98
R6440:Thsd1 UTSW 8 22258553 missense possibly damaging 0.59
R6457:Thsd1 UTSW 8 22243347 missense probably damaging 0.97
R6488:Thsd1 UTSW 8 22243717 missense probably benign 0.36
R6519:Thsd1 UTSW 8 22259065 missense probably damaging 1.00
R7267:Thsd1 UTSW 8 22243581 missense probably benign 0.10
R7448:Thsd1 UTSW 8 22243333 missense possibly damaging 0.89
R7698:Thsd1 UTSW 8 22258987 nonsense probably null
R7733:Thsd1 UTSW 8 22258721 missense probably damaging 1.00
R7792:Thsd1 UTSW 8 22243098 missense probably damaging 0.99
R7894:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
R7977:Thsd1 UTSW 8 22259569 missense probably damaging 0.99
X0023:Thsd1 UTSW 8 22259567 missense probably damaging 1.00
Z1088:Thsd1 UTSW 8 22252219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATGAAGAGAACATCTGCGAGCTG -3'
(R):5'- TCCTGAAGAGGGAACTTCTGGAGTG -3'

Sequencing Primer
(F):5'- CATCTGCGAGCTGAGTGAG -3'
(R):5'- AACTTCTGGAGTGGCACCTC -3'
Posted On2013-06-12