Incidental Mutation 'R2566:Rapgef6'
ID476639
Institutional Source Beutler Lab
Gene Symbol Rapgef6
Ensembl Gene ENSMUSG00000037533
Gene NameRap guanine nucleotide exchange factor (GEF) 6
SynonymsPDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2
MMRRC Submission 040425-MU
Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location54522847-54699285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54687711 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1028 (T1028A)
Ref Sequence ENSEMBL: ENSMUSP00000104522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094536
AA Change: T1020A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533
AA Change: T1020A

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 853 3.88e-84 SMART
low complexity region 944 957 N/A INTRINSIC
low complexity region 972 989 N/A INTRINSIC
low complexity region 1016 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101206
SMART Domains Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.45e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1095 5.35e-87 SMART
low complexity region 1237 1250 N/A INTRINSIC
low complexity region 1270 1293 N/A INTRINSIC
low complexity region 1345 1364 N/A INTRINSIC
low complexity region 1368 1380 N/A INTRINSIC
low complexity region 1444 1452 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1591 1604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102743
SMART Domains Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
internal_repeat_1 10 82 1.42e-5 PROSPERO
low complexity region 187 205 N/A INTRINSIC
low complexity region 231 239 N/A INTRINSIC
cNMP 280 398 4.8e-13 SMART
RasGEFN 412 525 4.35e-33 SMART
PDZ 540 612 8.86e-16 SMART
low complexity region 694 705 N/A INTRINSIC
RA 749 835 1.47e-20 SMART
RasGEF 856 1138 3.88e-84 SMART
low complexity region 1229 1242 N/A INTRINSIC
low complexity region 1262 1285 N/A INTRINSIC
low complexity region 1337 1356 N/A INTRINSIC
low complexity region 1360 1372 N/A INTRINSIC
low complexity region 1436 1444 N/A INTRINSIC
low complexity region 1547 1560 N/A INTRINSIC
low complexity region 1583 1596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108894
AA Change: T1028A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533
AA Change: T1028A

DomainStartEndE-ValueType
cNMP 1 113 6.64e-7 SMART
RasGEFN 127 240 4.35e-33 SMART
PDZ 255 327 8.86e-16 SMART
low complexity region 409 420 N/A INTRINSIC
RA 464 550 1.47e-20 SMART
RasGEF 571 810 5.35e-87 SMART
low complexity region 952 965 N/A INTRINSIC
low complexity region 980 997 N/A INTRINSIC
low complexity region 1024 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136494
SMART Domains Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533

DomainStartEndE-ValueType
low complexity region 47 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207429
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Rapgef6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Rapgef6 APN 11 54679265 missense probably benign 0.00
IGL00507:Rapgef6 APN 11 54664109 nonsense probably null
IGL00809:Rapgef6 APN 11 54649300 missense probably damaging 1.00
IGL00843:Rapgef6 APN 11 54691273 missense probably benign 0.03
IGL00899:Rapgef6 APN 11 54620018 nonsense probably null
IGL01372:Rapgef6 APN 11 54668611 splice site probably benign
IGL01604:Rapgef6 APN 11 54694563 missense probably damaging 0.99
IGL01935:Rapgef6 APN 11 54610842 missense possibly damaging 0.78
IGL01991:Rapgef6 APN 11 54552869 missense probably benign 0.37
IGL02243:Rapgef6 APN 11 54676400 missense probably damaging 1.00
IGL02407:Rapgef6 APN 11 54676355 missense possibly damaging 0.91
IGL02676:Rapgef6 APN 11 54649346 unclassified probably benign
IGL02934:Rapgef6 APN 11 54625864 missense probably damaging 1.00
IGL03076:Rapgef6 APN 11 54625967 missense probably damaging 1.00
IGL03110:Rapgef6 APN 11 54696089 missense probably damaging 0.97
IGL03256:Rapgef6 APN 11 54657429 missense probably damaging 1.00
shocker UTSW 11 54620016 missense probably damaging 1.00
D4216:Rapgef6 UTSW 11 54668746 splice site probably benign
PIT4305001:Rapgef6 UTSW 11 54679377 missense probably damaging 1.00
PIT4366001:Rapgef6 UTSW 11 54691620 missense probably damaging 0.98
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0047:Rapgef6 UTSW 11 54546378 missense possibly damaging 0.65
R0125:Rapgef6 UTSW 11 54625875 nonsense probably null
R0189:Rapgef6 UTSW 11 54691249 missense probably benign
R0201:Rapgef6 UTSW 11 54619941 missense probably damaging 1.00
R0505:Rapgef6 UTSW 11 54625963 missense probably benign 0.00
R0524:Rapgef6 UTSW 11 54690284 missense probably benign 0.32
R0853:Rapgef6 UTSW 11 54668677 missense probably damaging 1.00
R1203:Rapgef6 UTSW 11 54691699 missense probably benign 0.09
R1440:Rapgef6 UTSW 11 54626708 missense probably damaging 1.00
R1453:Rapgef6 UTSW 11 54639727 intron probably null
R1530:Rapgef6 UTSW 11 54661183 missense probably damaging 1.00
R1593:Rapgef6 UTSW 11 54546397 frame shift probably null
R1620:Rapgef6 UTSW 11 54626594 missense possibly damaging 0.88
R1628:Rapgef6 UTSW 11 54546397 frame shift probably null
R1629:Rapgef6 UTSW 11 54546397 frame shift probably null
R1630:Rapgef6 UTSW 11 54546397 frame shift probably null
R1634:Rapgef6 UTSW 11 54546397 frame shift probably null
R1640:Rapgef6 UTSW 11 54657405 missense probably damaging 1.00
R1686:Rapgef6 UTSW 11 54691632 missense possibly damaging 0.81
R1722:Rapgef6 UTSW 11 54546397 frame shift probably null
R1743:Rapgef6 UTSW 11 54676284 missense probably damaging 1.00
R1816:Rapgef6 UTSW 11 54694488 missense probably benign
R1851:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1852:Rapgef6 UTSW 11 54642811 missense probably benign 0.01
R1868:Rapgef6 UTSW 11 54546397 frame shift probably null
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1888:Rapgef6 UTSW 11 54660828 missense probably damaging 1.00
R1942:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R1943:Rapgef6 UTSW 11 54657263 missense possibly damaging 0.95
R2031:Rapgef6 UTSW 11 54552858 missense probably benign 0.30
R2087:Rapgef6 UTSW 11 54631249 missense probably damaging 1.00
R2106:Rapgef6 UTSW 11 54668686 missense probably benign 0.17
R2362:Rapgef6 UTSW 11 54694272 missense probably damaging 1.00
R2484:Rapgef6 UTSW 11 54642756 missense possibly damaging 0.48
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R2872:Rapgef6 UTSW 11 54661175 missense probably damaging 1.00
R3744:Rapgef6 UTSW 11 54625934 missense probably benign 0.40
R3848:Rapgef6 UTSW 11 54691308 missense probably damaging 0.97
R4823:Rapgef6 UTSW 11 54694500 missense probably benign 0.08
R4859:Rapgef6 UTSW 11 54636163 missense probably benign
R4906:Rapgef6 UTSW 11 54552836 missense probably damaging 1.00
R4911:Rapgef6 UTSW 11 54622317 missense probably damaging 0.97
R4937:Rapgef6 UTSW 11 54657317 missense probably damaging 1.00
R5033:Rapgef6 UTSW 11 54691381 missense possibly damaging 0.92
R5249:Rapgef6 UTSW 11 54523117 missense probably benign 0.19
R5304:Rapgef6 UTSW 11 54657374 missense probably benign 0.01
R5656:Rapgef6 UTSW 11 54636136 missense possibly damaging 0.95
R5701:Rapgef6 UTSW 11 54676394 missense possibly damaging 0.76
R5758:Rapgef6 UTSW 11 54668644 missense probably damaging 1.00
R5973:Rapgef6 UTSW 11 54639783 missense probably damaging 1.00
R6177:Rapgef6 UTSW 11 54620016 missense probably damaging 1.00
R6268:Rapgef6 UTSW 11 54649247 missense probably damaging 1.00
R6287:Rapgef6 UTSW 11 54626338 intron probably null
R6293:Rapgef6 UTSW 11 54634781 missense probably damaging 1.00
R6471:Rapgef6 UTSW 11 54691737 missense probably damaging 0.99
R6863:Rapgef6 UTSW 11 54546380 missense probably benign 0.00
R6950:Rapgef6 UTSW 11 54676380 missense probably benign 0.09
R7144:Rapgef6 UTSW 11 54657365 missense possibly damaging 0.78
R7171:Rapgef6 UTSW 11 54676363 missense possibly damaging 0.94
R7199:Rapgef6 UTSW 11 54546426 missense probably benign 0.00
R7291:Rapgef6 UTSW 11 54691239 missense probably benign 0.05
R7436:Rapgef6 UTSW 11 54610921 critical splice donor site probably null
R7498:Rapgef6 UTSW 11 54620004 missense probably damaging 1.00
R7506:Rapgef6 UTSW 11 54636171 missense probably benign 0.00
R7527:Rapgef6 UTSW 11 54634961 missense unknown
Predicted Primers
Posted On2017-05-11