Incidental Mutation 'R0507:Cx3cr1'
ID47671
Institutional Source Beutler Lab
Gene Symbol Cx3cr1
Ensembl Gene ENSMUSG00000052336
Gene Namechemokine (C-X3-C motif) receptor 1
Synonyms
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119901616-120069879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120051956 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 127 (D127Y)
Ref Sequence ENSEMBL: ENSMUSP00000150463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064165] [ENSMUST00000177637] [ENSMUST00000215016]
Predicted Effect probably damaging
Transcript: ENSMUST00000064165
AA Change: D127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063986
Gene: ENSMUSG00000052336
AA Change: D127Y

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 8.3e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177637
AA Change: D127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336
AA Change: D127Y

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215016
AA Change: D127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Age related retinal degeneration with abnormal subretinal microglial cell accumulation in one homozygous null mice. Other null mice shows impaired monocyte recruitment after vascular injury, kidney ischemia and reperfusion, and bacterial infection of the instestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Xpo1 T C 11: 23,294,682 V1020A possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Cx3cr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03339:Cx3cr1 APN 9 120051437 nonsense probably null
R1777:Cx3cr1 UTSW 9 120051593 missense probably damaging 1.00
R2099:Cx3cr1 UTSW 9 120052273 missense probably benign 0.00
R2120:Cx3cr1 UTSW 9 120051683 missense probably damaging 1.00
R3746:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3747:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3748:Cx3cr1 UTSW 9 120052066 missense probably damaging 1.00
R3939:Cx3cr1 UTSW 9 120051644 missense probably benign
R4629:Cx3cr1 UTSW 9 120051664 missense probably damaging 1.00
R6185:Cx3cr1 UTSW 9 120051378 missense probably benign 0.06
R6244:Cx3cr1 UTSW 9 120051694 missense probably damaging 1.00
R6790:Cx3cr1 UTSW 9 120051767 missense probably damaging 1.00
R7448:Cx3cr1 UTSW 9 120052216 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGTCACCCAGACACTCGTTGTCC -3'
(R):5'- GCGACATTGTGGCCTTTGGAAC -3'

Sequencing Primer
(F):5'- CTTTCTCTTTGTGAACATGAACTGG -3'
(R):5'- GTGGCCTTTGGAACCATCTTC -3'
Posted On2013-06-12