Mutagenetix > Incidental Mutations

Incidental Mutation 'R0507:Otogl'

47676

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

038702-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0507 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107866740 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 684 (V684A)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165341
AA Change: V684A

PolyPhen 2 Score 0.510 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: V684A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.1%
20x: 95.0%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931428F04Rik	T	C	8: 105,284,719	N261S	probably damaging	Het
Abca7	T	A	10: 80,002,821		probably benign	Het
Adamts16	T	C	13: 70,768,647	D742G	probably benign	Het
Akap9	G	A	5: 4,069,043	E3517K	probably benign	Het
Arfgef3	T	C	10: 18,591,621	T1944A	probably damaging	Het
Bsx	A	G	9: 40,876,500		probably benign	Het
Cct2	A	T	10: 117,055,246		probably null	Het
Cdkl4	T	C	17: 80,543,808	D155G	probably benign	Het
Cep250	C	T	2: 155,992,532	R2126C	possibly damaging	Het
Cep97	A	T	16: 55,905,882		probably benign	Het
Cpne3	C	T	4: 19,532,544		probably benign	Het
Csmd1	T	C	8: 16,185,344		probably benign	Het
Cx3cr1	C	A	9: 120,051,956	D127Y	probably damaging	Het
Dcdc2a	A	G	13: 25,102,589	Q165R	probably damaging	Het
Ddx17	A	G	15: 79,537,557		probably benign	Het
Dicer1	A	G	12: 104,691,658	S1886P	probably damaging	Het
Egf	T	C	3: 129,681,179	D571G	possibly damaging	Het
Fyb	A	G	15: 6,634,816	D460G	probably benign	Het
Gbp2	G	T	3: 142,630,033	D165Y	probably damaging	Het
Gm14124	T	A	2: 150,268,124	C245S	possibly damaging	Het
Gm14412	A	T	2: 177,314,532	N523K	possibly damaging	Het
Gsap	C	T	5: 21,269,963	T540I	possibly damaging	Het
Gucy2d	C	A	7: 98,459,002		probably null	Het
Icam4	C	A	9: 21,029,503	P17Q	possibly damaging	Het
Lyz1	A	T	10: 117,289,117		probably null	Het
Mbd6	A	G	10: 127,283,520		probably benign	Het
Mroh3	A	T	1: 136,190,980	I533N	probably damaging	Het
Muc4	A	T	16: 32,751,069	M316L	probably benign	Het
Myof	A	G	19: 37,901,277	I1282T	possibly damaging	Het
Ncald	T	G	15: 37,397,284	I51L	probably benign	Het
Negr1	T	A	3: 156,562,225	S11T	probably damaging	Het
Obscn	T	C	11: 59,029,341	N6735D	probably damaging	Het
Olfr1458	G	A	19: 13,103,278	R3C	possibly damaging	Het
Olfr1500	T	A	19: 13,827,776	I207F	possibly damaging	Het
Olfr503	T	C	7: 108,545,085	S185P	probably damaging	Het
Olfr786	A	T	10: 129,437,288	M159L	probably benign	Het
Palm3	A	G	8: 84,028,329	T157A	probably benign	Het
Pard3	T	A	8: 127,371,486		probably benign	Het
Pcdh15	A	G	10: 74,621,297	D1302G	probably damaging	Het
Pi16	G	A	17: 29,327,852	E467K	possibly damaging	Het
Plec	A	T	15: 76,172,783	I4183N	probably damaging	Het
Ppp1r13l	T	C	7: 19,375,814	L720P	possibly damaging	Het
Prag1	A	G	8: 36,104,123	E620G	probably damaging	Het
Ralbp1	G	A	17: 65,849,960	T646M	probably benign	Het
Rnf182	T	G	13: 43,668,347	S125A	probably benign	Het
Rpe	C	T	1: 66,715,141	T124I	probably benign	Het
Rufy4	T	C	1: 74,146,716	I514T	probably benign	Het
Sec13	A	T	6: 113,735,119	I85N	probably damaging	Het
Siglec1	C	T	2: 131,074,525		probably benign	Het
Skint5	T	C	4: 113,567,930		probably null	Het
Slc4a3	T	A	1: 75,556,081	I995K	probably damaging	Het
Smyd4	T	A	11: 75,399,708	S545T	possibly damaging	Het
Steap3	C	T	1: 120,241,583	R328H	possibly damaging	Het
Tgm6	G	A	2: 130,138,831	E183K	possibly damaging	Het
Themis	T	A	10: 28,781,832	V132E	possibly damaging	Het
Thsd1	T	A	8: 22,258,679	I461N	probably damaging	Het
Ttk	T	G	9: 83,868,067	S692A	probably damaging	Het
Twf1	A	G	15: 94,585,530	M99T	probably damaging	Het
Uchl3	T	A	14: 101,667,007	L89*	probably null	Het
Uhmk1	A	G	1: 170,207,191	V316A	probably damaging	Het
Unc80	A	G	1: 66,527,893	N886S	possibly damaging	Het
Vash2	G	T	1: 190,966,918		probably benign	Het
Vmn1r200	G	A	13: 22,395,548	E174K	probably benign	Het
Vps16	T	C	2: 130,437,712		probably null	Het
Wdr73	T	C	7: 80,891,846	E316G	possibly damaging	Het
Xpo1	T	C	11: 23,294,682	V1020A	possibly damaging	Het
Ylpm1	T	A	12: 85,029,112	N870K	probably benign	Het
Zfhx4	C	T	3: 5,400,988	Q2069*	probably null	Het
Zfp512b	C	A	2: 181,584,964		probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7286:Otogl	UTSW	10	107770610	missense	probably benign	0.00
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	unknown
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- CTCACCACAGAAGGAGATGTGAGC -3'
(R):5'- TTATACACGGGGAGGTCTGGAGATG -3'

Sequencing Primer
(F):5'- GCTCTGAAATCAATGGGCAC -3'
(R):5'- tttttcttttttcctctctctctctc -3'

Posted On

2013-06-12