Incidental Mutation 'R0507:Xpo1'
ID47681
Institutional Source Beutler Lab
Gene Symbol Xpo1
Ensembl Gene ENSMUSG00000020290
Gene Nameexportin 1
SynonymsCrm1
MMRRC Submission 038702-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0507 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23256041-23298249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23294682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1020 (V1020A)
Ref Sequence ENSEMBL: ENSMUSP00000105178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020538] [ENSMUST00000102869] [ENSMUST00000102870] [ENSMUST00000109551]
PDB Structure
Crystal Structure of the Nuclear Export Complex CRM1-Snurportin1-RanGTP [X-RAY DIFFRACTION]
Crystal structure of the PKI NES-CRM1-RanGTP nuclear export complex [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal I) [X-RAY DIFFRACTION]
Crystal structure of the HIV-1 Rev NES-CRM1-RanGTP nuclear export complex (crystal II) [X-RAY DIFFRACTION]
Crystal structure of the CRM1-RanGTP complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020538
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020538
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102869
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099933
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 7.4e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102870
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099934
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109551
AA Change: V1020A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000105178
Gene: ENSMUSG00000020290
AA Change: V1020A

DomainStartEndE-ValueType
IBN_N 46 112 2.3e-10 SMART
Pfam:Xpo1 123 268 1.3e-44 PFAM
Blast:IL1 407 518 9e-14 BLAST
Blast:CRM1_C 590 699 1e-22 BLAST
CRM1_C 709 1027 4.63e-211 SMART
Meta Mutation Damage Score 0.9287 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This cell-cycle-regulated gene encodes a protein that mediates leucine-rich nuclear export signal (NES)-dependent protein transport. The protein specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,719 N261S probably damaging Het
Abca7 T A 10: 80,002,821 probably benign Het
Adamts16 T C 13: 70,768,647 D742G probably benign Het
Akap9 G A 5: 4,069,043 E3517K probably benign Het
Arfgef3 T C 10: 18,591,621 T1944A probably damaging Het
Bsx A G 9: 40,876,500 probably benign Het
Cct2 A T 10: 117,055,246 probably null Het
Cdkl4 T C 17: 80,543,808 D155G probably benign Het
Cep250 C T 2: 155,992,532 R2126C possibly damaging Het
Cep97 A T 16: 55,905,882 probably benign Het
Cpne3 C T 4: 19,532,544 probably benign Het
Csmd1 T C 8: 16,185,344 probably benign Het
Cx3cr1 C A 9: 120,051,956 D127Y probably damaging Het
Dcdc2a A G 13: 25,102,589 Q165R probably damaging Het
Ddx17 A G 15: 79,537,557 probably benign Het
Dicer1 A G 12: 104,691,658 S1886P probably damaging Het
Egf T C 3: 129,681,179 D571G possibly damaging Het
Fyb A G 15: 6,634,816 D460G probably benign Het
Gbp2 G T 3: 142,630,033 D165Y probably damaging Het
Gm14124 T A 2: 150,268,124 C245S possibly damaging Het
Gm14412 A T 2: 177,314,532 N523K possibly damaging Het
Gsap C T 5: 21,269,963 T540I possibly damaging Het
Gucy2d C A 7: 98,459,002 probably null Het
Icam4 C A 9: 21,029,503 P17Q possibly damaging Het
Lyz1 A T 10: 117,289,117 probably null Het
Mbd6 A G 10: 127,283,520 probably benign Het
Mroh3 A T 1: 136,190,980 I533N probably damaging Het
Muc4 A T 16: 32,751,069 M316L probably benign Het
Myof A G 19: 37,901,277 I1282T possibly damaging Het
Ncald T G 15: 37,397,284 I51L probably benign Het
Negr1 T A 3: 156,562,225 S11T probably damaging Het
Obscn T C 11: 59,029,341 N6735D probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1500 T A 19: 13,827,776 I207F possibly damaging Het
Olfr503 T C 7: 108,545,085 S185P probably damaging Het
Olfr786 A T 10: 129,437,288 M159L probably benign Het
Otogl A G 10: 107,866,740 V684A possibly damaging Het
Palm3 A G 8: 84,028,329 T157A probably benign Het
Pard3 T A 8: 127,371,486 probably benign Het
Pcdh15 A G 10: 74,621,297 D1302G probably damaging Het
Pi16 G A 17: 29,327,852 E467K possibly damaging Het
Plec A T 15: 76,172,783 I4183N probably damaging Het
Ppp1r13l T C 7: 19,375,814 L720P possibly damaging Het
Prag1 A G 8: 36,104,123 E620G probably damaging Het
Ralbp1 G A 17: 65,849,960 T646M probably benign Het
Rnf182 T G 13: 43,668,347 S125A probably benign Het
Rpe C T 1: 66,715,141 T124I probably benign Het
Rufy4 T C 1: 74,146,716 I514T probably benign Het
Sec13 A T 6: 113,735,119 I85N probably damaging Het
Siglec1 C T 2: 131,074,525 probably benign Het
Skint5 T C 4: 113,567,930 probably null Het
Slc4a3 T A 1: 75,556,081 I995K probably damaging Het
Smyd4 T A 11: 75,399,708 S545T possibly damaging Het
Steap3 C T 1: 120,241,583 R328H possibly damaging Het
Tgm6 G A 2: 130,138,831 E183K possibly damaging Het
Themis T A 10: 28,781,832 V132E possibly damaging Het
Thsd1 T A 8: 22,258,679 I461N probably damaging Het
Ttk T G 9: 83,868,067 S692A probably damaging Het
Twf1 A G 15: 94,585,530 M99T probably damaging Het
Uchl3 T A 14: 101,667,007 L89* probably null Het
Uhmk1 A G 1: 170,207,191 V316A probably damaging Het
Unc80 A G 1: 66,527,893 N886S possibly damaging Het
Vash2 G T 1: 190,966,918 probably benign Het
Vmn1r200 G A 13: 22,395,548 E174K probably benign Het
Vps16 T C 2: 130,437,712 probably null Het
Wdr73 T C 7: 80,891,846 E316G possibly damaging Het
Ylpm1 T A 12: 85,029,112 N870K probably benign Het
Zfhx4 C T 3: 5,400,988 Q2069* probably null Het
Zfp512b C A 2: 181,584,964 probably benign Het
Other mutations in Xpo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Xpo1 APN 11 23285094 missense probably damaging 1.00
IGL01464:Xpo1 APN 11 23267703 missense probably damaging 0.97
IGL01561:Xpo1 APN 11 23282706 missense possibly damaging 0.76
IGL01630:Xpo1 APN 11 23285846 missense probably benign 0.00
IGL01700:Xpo1 APN 11 23276422 splice site probably benign
IGL02000:Xpo1 APN 11 23296003 missense probably damaging 1.00
IGL02299:Xpo1 APN 11 23293915 splice site probably benign
IGL02313:Xpo1 APN 11 23277065 missense probably damaging 1.00
IGL02828:Xpo1 APN 11 23282593 missense probably damaging 0.97
IGL03210:Xpo1 APN 11 23278834 missense probably benign 0.01
IGL03329:Xpo1 APN 11 23284306 missense probably benign
PIT1430001:Xpo1 UTSW 11 23276437 missense possibly damaging 0.66
R0594:Xpo1 UTSW 11 23280402 missense probably damaging 1.00
R0706:Xpo1 UTSW 11 23280441 missense probably benign 0.09
R0742:Xpo1 UTSW 11 23294682 missense possibly damaging 0.61
R1385:Xpo1 UTSW 11 23261863 missense probably damaging 0.96
R1478:Xpo1 UTSW 11 23291623 missense probably damaging 0.99
R1483:Xpo1 UTSW 11 23284863 missense probably benign 0.04
R1694:Xpo1 UTSW 11 23281399 missense probably benign 0.12
R1775:Xpo1 UTSW 11 23271193 missense probably benign
R1827:Xpo1 UTSW 11 23285155 missense probably benign 0.00
R2262:Xpo1 UTSW 11 23284634 unclassified probably null
R2263:Xpo1 UTSW 11 23284634 unclassified probably null
R4510:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4511:Xpo1 UTSW 11 23287401 missense possibly damaging 0.60
R4840:Xpo1 UTSW 11 23278183 missense probably damaging 1.00
R4901:Xpo1 UTSW 11 23281327 missense possibly damaging 0.62
R5176:Xpo1 UTSW 11 23295977 missense probably damaging 0.99
R5508:Xpo1 UTSW 11 23294645 missense probably benign
R5927:Xpo1 UTSW 11 23268653 unclassified probably benign
R5927:Xpo1 UTSW 11 23268656 unclassified probably benign
R6110:Xpo1 UTSW 11 23287434 missense probably damaging 0.99
R6421:Xpo1 UTSW 11 23291490 missense possibly damaging 0.60
R6591:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6691:Xpo1 UTSW 11 23286875 missense probably damaging 1.00
R6698:Xpo1 UTSW 11 23294040 missense probably benign 0.01
R6958:Xpo1 UTSW 11 23285855 missense probably benign
R7407:Xpo1 UTSW 11 23285823 missense probably damaging 1.00
R7482:Xpo1 UTSW 11 23282544 missense probably benign 0.00
R7624:Xpo1 UTSW 11 23282584 missense probably damaging 0.99
Z1176:Xpo1 UTSW 11 23296080 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCCGTAATGGACCCTAGATCACC -3'
(R):5'- GGAGGCCAATAGAATGCTTGCCTG -3'

Sequencing Primer
(F):5'- TTAGAGGCTGAGCCATCTGC -3'
(R):5'- GCTTGCCTGTTTAAAAAAAACACTTG -3'
Posted On2013-06-12