Incidental Mutation 'R0508:Tmem201'
ID47716
Institutional Source Beutler Lab
Gene Symbol Tmem201
Ensembl Gene ENSMUSG00000044700
Gene Nametransmembrane protein 201
SynonymsSamp1, D4Ertd429e
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R0508 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149715375-149738044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 149731886 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 62 (R62C)
Ref Sequence ENSEMBL: ENSMUSP00000101312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054459] [ENSMUST00000103208] [ENSMUST00000105687]
Predicted Effect probably damaging
Transcript: ENSMUST00000054459
AA Change: R62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050481
Gene: ENSMUSG00000044700
AA Change: R62C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.6e-43 PFAM
Pfam:DUF2448 191 392 4.4e-102 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103208
AA Change: R62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099497
Gene: ENSMUSG00000044700
AA Change: R62C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 1.1e-43 PFAM
Pfam:DUF2448 191 392 2.1e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105687
AA Change: R62C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101312
Gene: ENSMUSG00000044700
AA Change: R62C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ima1_N 46 171 2.4e-39 PFAM
Pfam:DUF2448 191 389 3.1e-96 PFAM
low complexity region 433 455 N/A INTRINSIC
low complexity region 486 521 N/A INTRINSIC
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145405
Meta Mutation Damage Score 0.5647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Tmem201
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Tmem201 APN 4 149719588 splice site probably benign
R0717:Tmem201 UTSW 4 149718810 missense probably damaging 1.00
R1660:Tmem201 UTSW 4 149719575 missense probably damaging 1.00
R2138:Tmem201 UTSW 4 149718080 missense probably damaging 1.00
R2971:Tmem201 UTSW 4 149722445 splice site probably benign
R4430:Tmem201 UTSW 4 149731139 missense probably benign 0.03
R4704:Tmem201 UTSW 4 149727317 missense possibly damaging 0.77
R4876:Tmem201 UTSW 4 149722270 missense probably damaging 1.00
R4966:Tmem201 UTSW 4 149718687 missense probably benign
R4991:Tmem201 UTSW 4 149728155 missense possibly damaging 0.95
R5518:Tmem201 UTSW 4 149718077 missense probably benign
R5818:Tmem201 UTSW 4 149727392 missense probably benign 0.33
R7399:Tmem201 UTSW 4 149731097 missense possibly damaging 0.95
R8142:Tmem201 UTSW 4 149718657 missense probably benign
X0064:Tmem201 UTSW 4 149718071 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- ACACAGTGCCAGGACCAGAGTTAG -3'
(R):5'- CGCAGTGTTTGAGACCCAGAACAG -3'

Sequencing Primer
(F):5'- CCAGGACCAGAGTTAGAAGAC -3'
(R):5'- ATACTTTGGAGCCTACAGAGC -3'
Posted On2013-06-12