Incidental Mutation 'R0508:Serpine1'
ID47719
Institutional Source Beutler Lab
Gene Symbol Serpine1
Ensembl Gene ENSMUSG00000037411
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 1
SynonymsPAI-1, PAI1, Planh1
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0508 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137061504-137072268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 137064916 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 315 (K315N)
Ref Sequence ENSEMBL: ENSMUSP00000076728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041388] [ENSMUST00000077523]
Predicted Effect probably benign
Transcript: ENSMUST00000041388
AA Change: K315N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039586
Gene: ENSMUSG00000037411
AA Change: K315N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077523
AA Change: K315N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076728
Gene: ENSMUSG00000037411
AA Change: K315N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 40 402 9.47e-158 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine proteinase inhibitor (serpin) superfamily. This member is the principal inhibitor of tissue plasminogen activator (tPA) and urokinase (uPA), and hence is an inhibitor of fibrinolysis. Defects in this gene are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency), and high concentrations of the gene product are associated with thrombophilia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Although mice homozygous for disruptions in this gene display an essentially normal phenotype, a mild blood clotting defect does exist. Mice homozygous for an allele with amino acid substitutions exhibit decreased sensitivity to LPS-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Serpine1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00919:Serpine1 APN 5 137063522 missense probably benign 0.01
IGL01337:Serpine1 APN 5 137069331 missense probably damaging 0.99
IGL01484:Serpine1 APN 5 137063472 splice site probably benign
IGL02134:Serpine1 APN 5 137067035 splice site probably benign
R1969:Serpine1 UTSW 5 137067747 nonsense probably null
R4515:Serpine1 UTSW 5 137069468 missense probably damaging 0.99
R4951:Serpine1 UTSW 5 137069351 missense probably benign 0.04
R5540:Serpine1 UTSW 5 137063209 missense probably benign 0.03
R7122:Serpine1 UTSW 5 137066942 missense probably benign 0.28
R7144:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7146:Serpine1 UTSW 5 137071064 missense probably damaging 1.00
R7844:Serpine1 UTSW 5 137071189 nonsense probably null
R7927:Serpine1 UTSW 5 137071189 nonsense probably null
R8042:Serpine1 UTSW 5 137067001 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGCAGTGCCTGTGCTACAGAG -3'
(R):5'- ATGCTCGTGTCAGTGTCTACCCTG -3'

Sequencing Primer
(F):5'- GTCTGTAACAGAGCAGGACCC -3'
(R):5'- GTCCCACTGTCCTAGAAGATATCC -3'
Posted On2013-06-12