Incidental Mutation 'R0508:Arhgap32'
ID47731
Institutional Source Beutler Lab
Gene Symbol Arhgap32
Ensembl Gene ENSMUSG00000041444
Gene NameRho GTPase activating protein 32
Synonymsp200RhoGAP, Grit, GC-GAP, PX-RICS, 3426406O18Rik
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0508 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location32116136-32268446 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 32190068 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174641]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174314
Predicted Effect probably benign
Transcript: ENSMUST00000174641
SMART Domains Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444

DomainStartEndE-ValueType
Pfam:PX 132 226 5.6e-7 PFAM
SH3 262 320 7.4e-11 SMART
RhoGAP 383 564 9.6e-60 SMART
Blast:RhoGAP 581 647 9e-31 BLAST
low complexity region 867 882 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1045 1059 N/A INTRINSIC
low complexity region 1262 1275 N/A INTRINSIC
low complexity region 1309 1323 N/A INTRINSIC
low complexity region 1346 1357 N/A INTRINSIC
low complexity region 1425 1442 N/A INTRINSIC
low complexity region 1653 1666 N/A INTRINSIC
low complexity region 2040 2049 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Arhgap32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgap32 APN 9 32257361 missense probably benign 0.00
IGL01317:Arhgap32 APN 9 32256964 missense probably benign 0.30
IGL01614:Arhgap32 APN 9 32260505 missense probably damaging 1.00
IGL01791:Arhgap32 APN 9 32247190 missense probably damaging 0.96
IGL02318:Arhgap32 APN 9 32259331 missense probably benign 0.00
IGL02542:Arhgap32 APN 9 32255648 missense probably damaging 1.00
IGL02568:Arhgap32 APN 9 32247194 missense probably damaging 1.00
IGL02627:Arhgap32 APN 9 32246006 missense probably damaging 1.00
IGL02927:Arhgap32 APN 9 32261135 missense possibly damaging 0.95
IGL03157:Arhgap32 APN 9 32259134 missense probably damaging 1.00
IGL03286:Arhgap32 APN 9 32259520 missense probably benign 0.06
PIT4445001:Arhgap32 UTSW 9 32260856 missense probably damaging 1.00
R0004:Arhgap32 UTSW 9 32151998 missense probably damaging 0.98
R0335:Arhgap32 UTSW 9 32259760 missense probably benign 0.00
R0380:Arhgap32 UTSW 9 32246477 missense probably damaging 1.00
R0396:Arhgap32 UTSW 9 32245255 critical splice donor site probably null
R0494:Arhgap32 UTSW 9 32258903 missense probably damaging 0.98
R0856:Arhgap32 UTSW 9 32260220 missense probably damaging 1.00
R0990:Arhgap32 UTSW 9 32255381 missense probably damaging 1.00
R1312:Arhgap32 UTSW 9 32255312 missense probably benign
R1455:Arhgap32 UTSW 9 32260085 missense probably benign 0.08
R1515:Arhgap32 UTSW 9 32116202 missense probably benign
R1523:Arhgap32 UTSW 9 32256752 missense probably damaging 1.00
R1651:Arhgap32 UTSW 9 32259800 missense probably damaging 1.00
R1743:Arhgap32 UTSW 9 32259431 missense probably benign 0.00
R1999:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2098:Arhgap32 UTSW 9 32259911 missense probably damaging 1.00
R2150:Arhgap32 UTSW 9 32116140 missense possibly damaging 0.52
R2256:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2257:Arhgap32 UTSW 9 32247497 missense probably damaging 0.99
R2989:Arhgap32 UTSW 9 32239398 missense possibly damaging 0.54
R3780:Arhgap32 UTSW 9 32152019 splice site probably null
R3793:Arhgap32 UTSW 9 32255373 missense probably damaging 1.00
R3846:Arhgap32 UTSW 9 32190024 missense probably benign 0.03
R4086:Arhgap32 UTSW 9 32247066 unclassified probably benign
R4177:Arhgap32 UTSW 9 32247214 missense probably null 1.00
R4230:Arhgap32 UTSW 9 32257474 missense probably benign 0.10
R4280:Arhgap32 UTSW 9 32259889 missense probably damaging 0.98
R4504:Arhgap32 UTSW 9 32181839 splice site probably null
R4587:Arhgap32 UTSW 9 32260945 missense probably benign 0.02
R4612:Arhgap32 UTSW 9 32259479 missense probably damaging 0.99
R4622:Arhgap32 UTSW 9 32239348 missense possibly damaging 0.75
R4670:Arhgap32 UTSW 9 32170145 missense probably benign 0.03
R4784:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4784:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4785:Arhgap32 UTSW 9 32129653 missense probably damaging 0.99
R4785:Arhgap32 UTSW 9 32260780 missense probably damaging 1.00
R4906:Arhgap32 UTSW 9 32245256 critical splice donor site probably null
R5046:Arhgap32 UTSW 9 32256799 missense probably damaging 1.00
R5360:Arhgap32 UTSW 9 32259671 missense probably damaging 1.00
R5382:Arhgap32 UTSW 9 32152010 missense probably damaging 1.00
R5445:Arhgap32 UTSW 9 32248382 missense probably benign 0.19
R5637:Arhgap32 UTSW 9 32247206 missense probably damaging 1.00
R5659:Arhgap32 UTSW 9 32181960 missense probably damaging 1.00
R5801:Arhgap32 UTSW 9 32255788 missense probably benign 0.01
R6002:Arhgap32 UTSW 9 32256979 missense probably benign 0.00
R6109:Arhgap32 UTSW 9 32260111 missense probably damaging 1.00
R6405:Arhgap32 UTSW 9 32248488 missense probably benign 0.31
R6922:Arhgap32 UTSW 9 32152687 missense possibly damaging 0.86
R7009:Arhgap32 UTSW 9 32245976 missense probably damaging 1.00
R7137:Arhgap32 UTSW 9 32151936 missense probably benign 0.32
R7183:Arhgap32 UTSW 9 32186383 missense probably benign 0.15
R7251:Arhgap32 UTSW 9 32208185 missense probably damaging 1.00
R7287:Arhgap32 UTSW 9 32152697 missense
R7289:Arhgap32 UTSW 9 32256937 missense possibly damaging 0.92
R7289:Arhgap32 UTSW 9 32256938 missense probably benign 0.02
R7391:Arhgap32 UTSW 9 32181939 missense probably benign 0.00
R7408:Arhgap32 UTSW 9 32245924 missense probably benign 0.06
R7566:Arhgap32 UTSW 9 32250722 missense probably benign 0.10
R7584:Arhgap32 UTSW 9 32256967 missense probably benign 0.16
R7653:Arhgap32 UTSW 9 32257145 missense probably benign
R7884:Arhgap32 UTSW 9 32260514 missense possibly damaging 0.87
R8087:Arhgap32 UTSW 9 32257028 missense probably benign 0.00
R8109:Arhgap32 UTSW 9 32181854 missense probably benign 0.09
R8131:Arhgap32 UTSW 9 32247130 missense probably damaging 1.00
R8155:Arhgap32 UTSW 9 32181900 missense probably damaging 1.00
R8232:Arhgap32 UTSW 9 32256902 missense probably damaging 1.00
R8303:Arhgap32 UTSW 9 32260909 missense probably benign 0.00
R8304:Arhgap32 UTSW 9 32255937 nonsense probably null
X0027:Arhgap32 UTSW 9 32250641 critical splice acceptor site probably null
X0063:Arhgap32 UTSW 9 32261069 missense probably damaging 1.00
Z1177:Arhgap32 UTSW 9 32260680 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCAGAAGTGATGGTGATGCAGTGATAC -3'
(R):5'- GGCAGGACAGTACTACTACATGCAGG -3'

Sequencing Primer
(F):5'- acttgttgtcctcttctgacc -3'
(R):5'- GGAATCAAGGCTAACACTGTCATC -3'
Posted On2013-06-12