Incidental Mutation 'R0508:Coq6'
ID47742
Institutional Source Beutler Lab
Gene Symbol Coq6
Ensembl Gene ENSMUSG00000021235
Gene Namecoenzyme Q6 monooxygenase
Synonyms5930427M12Rik
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0508 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location84361657-84373796 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 84368139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021661] [ENSMUST00000110276] [ENSMUST00000110278] [ENSMUST00000152913]
Predicted Effect probably benign
Transcript: ENSMUST00000021661
SMART Domains Protein: ENSMUSP00000021661
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 3.9e-8 PFAM
Pfam:FAD_binding_3 334 435 1.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110276
SMART Domains Protein: ENSMUSP00000105905
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 5.1e-8 PFAM
Pfam:FAD_binding_3 334 435 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110278
SMART Domains Protein: ENSMUSP00000105907
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 46 56 N/A INTRINSIC
Pfam:FAD_binding_3 195 328 6.8e-8 PFAM
Pfam:FAD_binding_3 334 410 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140961
Predicted Effect probably benign
Transcript: ENSMUST00000145522
SMART Domains Protein: ENSMUSP00000117609
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SCOP:d1foha5 35 167 2e-6 SMART
PDB:4K22|B 90 156 3e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150391
Predicted Effect probably benign
Transcript: ENSMUST00000152913
SMART Domains Protein: ENSMUSP00000115676
Gene: ENSMUSG00000021235

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1foha5 39 269 1e-10 SMART
PDB:4K22|B 94 274 1e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153450
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156592
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Coq6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0607:Coq6 UTSW 12 84368638 missense possibly damaging 0.95
R1221:Coq6 UTSW 12 84371527 missense possibly damaging 0.96
R1885:Coq6 UTSW 12 84372464 missense probably damaging 1.00
R1898:Coq6 UTSW 12 84366963 missense probably benign 0.38
R3153:Coq6 UTSW 12 84371535 missense probably damaging 1.00
R3824:Coq6 UTSW 12 84372415 splice site probably benign
R4015:Coq6 UTSW 12 84366897 missense probably benign 0.00
R4241:Coq6 UTSW 12 84373789 utr 3 prime probably benign
R4285:Coq6 UTSW 12 84370404 intron probably benign
R4353:Coq6 UTSW 12 84368149 missense probably damaging 0.99
R4598:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4599:Coq6 UTSW 12 84362139 missense probably benign 0.00
R4868:Coq6 UTSW 12 84370952 missense probably damaging 0.99
R4887:Coq6 UTSW 12 84372296 missense probably damaging 1.00
R5567:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5570:Coq6 UTSW 12 84368639 missense probably benign 0.10
R5715:Coq6 UTSW 12 84366907 missense probably benign 0.10
R6608:Coq6 UTSW 12 84372148 missense probably benign 0.00
R7035:Coq6 UTSW 12 84368641 missense probably damaging 0.99
R7096:Coq6 UTSW 12 84361821 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGAGAGAGGAAGGACCTTGTC -3'
(R):5'- ATGTCATCCAGGTTGTCCCTGTCG -3'

Sequencing Primer
(F):5'- GAGGAAGGACCTTGTCCCTAAC -3'
(R):5'- acctgtgaccccaactcc -3'
Posted On2013-06-12