Mutagenetix > Incidental Mutation

Incidental Mutation 'R0508:Ap3b1'

47744

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

038703-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.459) question?

Stock #

R0508 (G1)

Quality Score

169

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 94565714 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1092 (S1092P)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

unknown
Transcript: ENSMUST00000022196
AA Change: S1092P

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: S1092P

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221206

Predicted Effect

unknown
Transcript: ENSMUST00000231916
AA Change: S470P

Meta Mutation Damage Score

0.4433

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 92.0%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	T	C	12: 71,164,388	L632P	probably damaging	Het
4833439L19Rik	A	G	13: 54,553,050		probably null	Het
Abca4	T	C	3: 122,123,551		probably benign	Het
Adamts10	G	T	17: 33,543,718	G557V	probably damaging	Het
Adgrg6	T	C	10: 14,450,616	H424R	probably benign	Het
Ano4	T	C	10: 88,980,977	Q623R	probably damaging	Het
Ap1g1	T	A	8: 109,837,732		probably benign	Het
Arhgap32	A	T	9: 32,190,068		probably benign	Het
Arhgap40	A	T	2: 158,546,750	S535C	probably damaging	Het
Atp9a	T	C	2: 168,649,526		probably null	Het
Bicral	A	T	17: 46,825,401	H294Q	possibly damaging	Het
Cdhr5	T	A	7: 141,272,899	H58L	probably benign	Het
Cenpt	T	C	8: 105,849,515	E100G	possibly damaging	Het
Cep97	A	G	16: 55,930,606	S16P	probably benign	Het
Clec2i	T	A	6: 128,893,700	V67D	probably damaging	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Coq6	G	T	12: 84,368,139		probably benign	Het
Cyp1a1	A	G	9: 57,700,305	Q72R	probably benign	Het
Ep400	A	G	5: 110,739,508	S570P	probably benign	Het
Erbin	T	C	13: 103,834,027	N1027S	probably damaging	Het
Exog	T	A	9: 119,448,378		probably benign	Het
Fahd1	A	C	17: 24,850,001	V34G	probably benign	Het
Fam160b1	T	A	19: 57,378,742	L239Q	probably benign	Het
Fetub	C	T	16: 22,929,295	R74W	probably benign	Het
Frmpd1	G	A	4: 45,284,938	G1253D	unknown	Het
Galnt12	A	G	4: 47,104,255	D171G	probably damaging	Het
Gm6583	T	C	5: 112,354,819	K340E	probably damaging	Het
Gm765	T	C	6: 98,238,044		probably benign	Het
Gm973	G	T	1: 59,582,490		probably benign	Het
Hdlbp	C	A	1: 93,414,811		probably null	Het
Il1rl1	T	A	1: 40,451,717	I386N	possibly damaging	Het
Itgav	T	C	2: 83,792,658		probably benign	Het
Magoh	A	C	4: 107,884,998	K114Q	possibly damaging	Het
Mki67	A	T	7: 135,700,346	D986E	probably benign	Het
Muc4	G	A	16: 32,751,313	S397N	possibly damaging	Het
Nckap5	T	C	1: 125,981,384		probably null	Het
Neu1	A	G	17: 34,932,784	I185V	probably benign	Het
Nkiras1	T	A	14: 18,278,524	D79E	probably damaging	Het
Nkx3-1	A	G	14: 69,190,901	E66G	probably benign	Het
Olfr586	A	T	7: 103,121,986	I262N	possibly damaging	Het
Osbpl11	T	A	16: 33,196,095	N73K	probably benign	Het
Otulin	C	T	15: 27,608,858	V2I	possibly damaging	Het
Pdss2	CGGAG	CG	10: 43,221,931		probably benign	Het
Pld2	T	C	11: 70,552,542	M421T	probably damaging	Het
Rgs11	A	G	17: 26,207,469		probably benign	Het
Rrad	A	T	8: 104,629,868	D133E	possibly damaging	Het
Scaf11	A	G	15: 96,420,487	S399P	probably damaging	Het
Sccpdh	A	G	1: 179,680,515		probably null	Het
Scn2a	A	G	2: 65,717,842	E1126G	probably damaging	Het
Selenop	T	G	15: 3,275,720	D119E	probably benign	Het
Serpinb3c	T	A	1: 107,276,921	S32C	probably damaging	Het
Serpine1	C	A	5: 137,064,916	K315N	probably benign	Het
Slc27a1	T	C	8: 71,580,228		probably benign	Het
Slc4a8	G	A	15: 100,789,092	R259Q	probably benign	Het
Smtnl2	C	T	11: 72,403,136	R198Q	probably damaging	Het
Spta1	A	C	1: 174,224,457	Y1819S	probably damaging	Het
Stard3	T	A	11: 98,372,314	I65N	probably damaging	Het
Tfrc	T	C	16: 32,630,179	L712P	probably damaging	Het
Tmem201	G	A	4: 149,731,886	R62C	probably damaging	Het
Trim5	A	T	7: 104,265,604	F410L	probably null	Het
Txndc2	T	A	17: 65,637,953	I410F	probably benign	Het
Urb1	C	T	16: 90,783,262		probably benign	Het
Vmn1r34	A	T	6: 66,637,408	F115L	probably benign	Het
Vnn1	T	C	10: 23,895,012	V46A	probably benign	Het
Xrn1	T	A	9: 96,051,736	S1615R	probably benign	Het
Zfand4	T	A	6: 116,285,867	C118S	probably damaging	Het
Zfp952	G	A	17: 33,003,005	E115K	possibly damaging	Het
Zfpm1	T	C	8: 122,335,133	F368L	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451086	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R8892:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGAACGGATGCCGTCTGCTC -3'
(R):5'- GATTGCCAAGCACTGATTCACACC -3'

Sequencing Primer
(F):5'- CCTCCTTTTCCCCTCTCAGG -3'
(R):5'- AATGCTACTCGGACTGGGG -3'

Posted On

2013-06-12