Incidental Mutation 'R2989:Intu'
ID 477448
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2989 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 40647140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 671 (K671R)
Ref Sequence ENSEMBL: ENSMUSP00000088725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: K671R

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: K671R

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204176
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 G A 13: 81,729,866 (GRCm39) T205I probably damaging Het
Arhgap32 T A 9: 32,150,694 (GRCm39) N31K possibly damaging Het
C1galt1 A G 6: 7,866,622 (GRCm39) D156G possibly damaging Het
Chrna3 C T 9: 54,923,334 (GRCm39) C158Y probably damaging Het
Cnot1 T C 8: 96,470,906 (GRCm39) E1314G possibly damaging Het
Coil C A 11: 88,878,805 (GRCm39) A520D probably damaging Het
Cpe G T 8: 65,050,549 (GRCm39) N386K probably benign Het
Fat4 T C 3: 39,061,302 (GRCm39) I4295T probably benign Het
Foxn1 C G 11: 78,249,603 (GRCm39) G641R possibly damaging Het
G530012D18Rik GAGAGAGACAGAGAGACAGAGA GAGAGAGACAGAGA 1: 85,504,937 (GRCm39) probably null Het
Jup T C 11: 100,267,667 (GRCm39) D552G possibly damaging Het
Kcnk9 T C 15: 72,384,207 (GRCm39) T324A unknown Het
Mettl5 G T 2: 69,711,659 (GRCm39) A69E probably damaging Het
Or8b3b A T 9: 38,583,831 (GRCm39) M303K probably benign Het
Rpf2 A G 10: 40,115,749 (GRCm39) S77P probably benign Het
Sgo1 A G 17: 53,994,162 (GRCm39) Y97H probably benign Het
Srsf12 T C 4: 33,223,599 (GRCm39) Y33H probably damaging Het
Tcerg1 T A 18: 42,652,540 (GRCm39) M56K unknown Het
Trafd1 T C 5: 121,517,529 (GRCm39) T63A probably damaging Het
Ttc28 G A 5: 111,371,881 (GRCm39) V777I probably benign Het
Ubr4 A G 4: 139,190,869 (GRCm39) E937G possibly damaging Het
Zfp677 T C 17: 21,617,114 (GRCm39) I57T probably benign Het
Zfp981 T A 4: 146,622,347 (GRCm39) I424N probably benign Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6063:Intu UTSW 3 40,608,524 (GRCm39) missense probably damaging 0.97
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers
Posted On 2017-05-15