Incidental Mutation 'R0508:Fetub'
ID 47752
Institutional Source Beutler Lab
Gene Symbol Fetub
Ensembl Gene ENSMUSG00000022871
Gene Name fetuin beta
Synonyms 2310011O17Rik, D17980
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R0508 (G1)
Quality Score 176
Status Validated
Chromosome 16
Chromosomal Location 22918334-22939778 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 22929295 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 74 (R74W)
Ref Sequence ENSEMBL: ENSMUSP00000155898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023587] [ENSMUST00000116625] [ENSMUST00000167399] [ENSMUST00000170805] [ENSMUST00000231768] [ENSMUST00000231880] [ENSMUST00000232097]
AlphaFold Q9QXC1
Predicted Effect probably benign
Transcript: ENSMUST00000023587
AA Change: R74W

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000023587
Gene: ENSMUSG00000022871
AA Change: R74W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116625
SMART Domains Protein: ENSMUSP00000112324
Gene: ENSMUSG00000022871

DomainStartEndE-ValueType
Blast:CY 1 61 4e-33 BLAST
CY 73 175 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167399
AA Change: R74W

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128745
Gene: ENSMUSG00000022871
AA Change: R74W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170805
AA Change: R74W

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128989
Gene: ENSMUSG00000022871
AA Change: R74W

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
CY 28 129 1.05e-2 SMART
CY 153 255 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231768
AA Change: R74W

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000231880
Predicted Effect probably benign
Transcript: ENSMUST00000232097
AA Change: R74W

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fetuin family, part of the cystatin superfamily of cysteine protease inhibitors. Fetuins have been implicated in several diverse functions, including osteogenesis and bone resorption, regulation of the insulin and hepatocyte growth factor receptors, and response to systemic inflammation. This protein may be secreted by cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female infertility due to premature hardening of the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fam160b1 T A 19: 57,378,742 L239Q probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Fetub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Fetub APN 16 22935696 missense probably benign 0.29
IGL00843:Fetub APN 16 22929629 splice site probably benign
IGL01450:Fetub APN 16 22929236 missense probably benign 0.01
IGL01522:Fetub APN 16 22929641 start codon destroyed probably null 0.10
IGL02222:Fetub APN 16 22932328 missense probably damaging 1.00
IGL02745:Fetub APN 16 22937926 missense probably damaging 0.99
R0062:Fetub UTSW 16 22929086 intron probably benign
R0310:Fetub UTSW 16 22929756 splice site probably benign
R0604:Fetub UTSW 16 22935660 missense possibly damaging 0.78
R1560:Fetub UTSW 16 22939367 missense probably benign 0.00
R1844:Fetub UTSW 16 22935669 missense possibly damaging 0.94
R1896:Fetub UTSW 16 22932295 missense probably damaging 1.00
R3716:Fetub UTSW 16 22935693 missense probably damaging 1.00
R3717:Fetub UTSW 16 22935693 missense probably damaging 1.00
R4274:Fetub UTSW 16 22935679 missense probably damaging 1.00
R4751:Fetub UTSW 16 22937895 missense probably benign 0.02
R4941:Fetub UTSW 16 22937874 missense probably benign 0.01
R5468:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5470:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5690:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5692:Fetub UTSW 16 22932331 missense probably damaging 1.00
R5781:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6038:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6039:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6193:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6195:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6244:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6245:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6273:Fetub UTSW 16 22932331 missense probably damaging 1.00
R6274:Fetub UTSW 16 22932331 missense probably damaging 1.00
R7134:Fetub UTSW 16 22929257 missense possibly damaging 0.54
R7698:Fetub UTSW 16 22939309 missense probably benign 0.31
R7969:Fetub UTSW 16 22929699 missense possibly damaging 0.89
R8437:Fetub UTSW 16 22934235 missense possibly damaging 0.57
R8788:Fetub UTSW 16 22939432 nonsense probably null
R8855:Fetub UTSW 16 22939571 missense possibly damaging 0.61
R8866:Fetub UTSW 16 22939571 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACATCCTGGATCTTGTTCCCCACAG -3'
(R):5'- TGCTCTGCTATACTCCTGAAGCCTG -3'

Sequencing Primer
(F):5'- TTGTTCCCCACAGAATGGGC -3'
(R):5'- TATACTCCTGAAGCCTGGACCTG -3'
Posted On 2013-06-12