Incidental Mutation 'R3035:Ighv1-54'
ID477566
Institutional Source Beutler Lab
Gene Symbol Ighv1-54
Ensembl Gene ENSMUSG00000094787
Gene Nameimmunoglobulin heavy variable V1-54
Synonyms
MMRRC Submission 040551-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R3035 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location115193675-115194134 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 115193977 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 17 (V17F)
Ref Sequence ENSEMBL: ENSMUSP00000100306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103525]
Predicted Effect probably damaging
Transcript: ENSMUST00000103525
AA Change: V17F

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100306
Gene: ENSMUSG00000094787
AA Change: V17F

DomainStartEndE-ValueType
IGv 36 117 1.09e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T A 2: 68,745,418 V687D probably benign Het
Ahctf1 T A 1: 179,753,870 Q1589L probably damaging Het
Apba2 T C 7: 64,739,792 S479P probably benign Het
C1galt1 A G 6: 7,866,762 K203E probably benign Het
Dennd5a A G 7: 109,921,352 S433P probably benign Het
Dock9 A G 14: 121,606,837 S1181P possibly damaging Het
Gsc2 A G 16: 17,914,928 S26P probably damaging Het
Hcn4 T C 9: 58,823,680 S57P unknown Het
Herc1 C A 9: 66,483,935 Q4007K possibly damaging Het
Kctd12 T A 14: 102,981,506 E312V possibly damaging Het
Kdf1 A G 4: 133,528,062 N30S probably benign Het
Kif11 T A 19: 37,407,053 S587T possibly damaging Het
Mbl1 C A 14: 41,158,833 S226Y probably damaging Het
Mgam A G 6: 40,663,530 I511V probably benign Het
Rab36 G A 10: 75,044,496 V63I probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Serpinb9b T A 13: 33,029,546 C29S possibly damaging Het
Slc12a5 C A 2: 164,980,258 L343I probably benign Het
Topors C T 4: 40,269,673 probably null Het
Other mutations in Ighv1-54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Ighv1-54 APN 12 115193937 missense probably damaging 1.00
IGL02195:Ighv1-54 APN 12 115193950 missense possibly damaging 0.75
IGL02561:Ighv1-54 APN 12 115193769 missense probably benign 0.22
IGL03084:Ighv1-54 APN 12 115194116 utr 5 prime probably benign
R3767:Ighv1-54 UTSW 12 115193976 missense possibly damaging 0.92
R4856:Ighv1-54 UTSW 12 115193803 missense probably damaging 1.00
R4948:Ighv1-54 UTSW 12 115193818 missense probably benign 0.35
R6091:Ighv1-54 UTSW 12 115193877 missense probably benign 0.00
R7843:Ighv1-54 UTSW 12 115193863 missense probably damaging 1.00
R7926:Ighv1-54 UTSW 12 115193863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTAGTACCACCACTTCCAG -3'
(R):5'- AATACTGGGATGTCCACACCC -3'

Sequencing Primer
(F):5'- TAGTACCACCACTTCCAGGATTAATC -3'
(R):5'- ACCTATGATCAGTGTACTCTCAACAG -3'
Posted On2017-05-15