Incidental Mutation 'R0508:Fam160b1'
ID47764
Institutional Source Beutler Lab
Gene Symbol Fam160b1
Ensembl Gene ENSMUSG00000033478
Gene Namefamily with sequence similarity 160, member B1
Synonyms
MMRRC Submission 038703-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R0508 (G1)
Quality Score170
Status Validated
Chromosome19
Chromosomal Location57361009-57389594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57378742 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 239 (L239Q)
Ref Sequence ENSEMBL: ENSMUSP00000048903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036407]
Predicted Effect probably benign
Transcript: ENSMUST00000036407
AA Change: L239Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048903
Gene: ENSMUSG00000033478
AA Change: L239Q

DomainStartEndE-ValueType
Pfam:RAI16-like 78 495 1.1e-144 PFAM
low complexity region 713 724 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 92.0%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik T C 12: 71,164,388 L632P probably damaging Het
4833439L19Rik A G 13: 54,553,050 probably null Het
Abca4 T C 3: 122,123,551 probably benign Het
Adamts10 G T 17: 33,543,718 G557V probably damaging Het
Adgrg6 T C 10: 14,450,616 H424R probably benign Het
Ano4 T C 10: 88,980,977 Q623R probably damaging Het
Ap1g1 T A 8: 109,837,732 probably benign Het
Ap3b1 T C 13: 94,565,714 S1092P unknown Het
Arhgap32 A T 9: 32,190,068 probably benign Het
Arhgap40 A T 2: 158,546,750 S535C probably damaging Het
Atp9a T C 2: 168,649,526 probably null Het
Bicral A T 17: 46,825,401 H294Q possibly damaging Het
Cdhr5 T A 7: 141,272,899 H58L probably benign Het
Cenpt T C 8: 105,849,515 E100G possibly damaging Het
Cep97 A G 16: 55,930,606 S16P probably benign Het
Clec2i T A 6: 128,893,700 V67D probably damaging Het
Col22a1 A G 15: 71,933,413 L146P unknown Het
Coq6 G T 12: 84,368,139 probably benign Het
Cyp1a1 A G 9: 57,700,305 Q72R probably benign Het
Ep400 A G 5: 110,739,508 S570P probably benign Het
Erbin T C 13: 103,834,027 N1027S probably damaging Het
Exog T A 9: 119,448,378 probably benign Het
Fahd1 A C 17: 24,850,001 V34G probably benign Het
Fetub C T 16: 22,929,295 R74W probably benign Het
Frmpd1 G A 4: 45,284,938 G1253D unknown Het
Galnt12 A G 4: 47,104,255 D171G probably damaging Het
Gm6583 T C 5: 112,354,819 K340E probably damaging Het
Gm765 T C 6: 98,238,044 probably benign Het
Gm973 G T 1: 59,582,490 probably benign Het
Hdlbp C A 1: 93,414,811 probably null Het
Il1rl1 T A 1: 40,451,717 I386N possibly damaging Het
Itgav T C 2: 83,792,658 probably benign Het
Magoh A C 4: 107,884,998 K114Q possibly damaging Het
Mki67 A T 7: 135,700,346 D986E probably benign Het
Muc4 G A 16: 32,751,313 S397N possibly damaging Het
Nckap5 T C 1: 125,981,384 probably null Het
Neu1 A G 17: 34,932,784 I185V probably benign Het
Nkiras1 T A 14: 18,278,524 D79E probably damaging Het
Nkx3-1 A G 14: 69,190,901 E66G probably benign Het
Olfr586 A T 7: 103,121,986 I262N possibly damaging Het
Osbpl11 T A 16: 33,196,095 N73K probably benign Het
Otulin C T 15: 27,608,858 V2I possibly damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pld2 T C 11: 70,552,542 M421T probably damaging Het
Rgs11 A G 17: 26,207,469 probably benign Het
Rrad A T 8: 104,629,868 D133E possibly damaging Het
Scaf11 A G 15: 96,420,487 S399P probably damaging Het
Sccpdh A G 1: 179,680,515 probably null Het
Scn2a A G 2: 65,717,842 E1126G probably damaging Het
Selenop T G 15: 3,275,720 D119E probably benign Het
Serpinb3c T A 1: 107,276,921 S32C probably damaging Het
Serpine1 C A 5: 137,064,916 K315N probably benign Het
Slc27a1 T C 8: 71,580,228 probably benign Het
Slc4a8 G A 15: 100,789,092 R259Q probably benign Het
Smtnl2 C T 11: 72,403,136 R198Q probably damaging Het
Spta1 A C 1: 174,224,457 Y1819S probably damaging Het
Stard3 T A 11: 98,372,314 I65N probably damaging Het
Tfrc T C 16: 32,630,179 L712P probably damaging Het
Tmem201 G A 4: 149,731,886 R62C probably damaging Het
Trim5 A T 7: 104,265,604 F410L probably null Het
Txndc2 T A 17: 65,637,953 I410F probably benign Het
Urb1 C T 16: 90,783,262 probably benign Het
Vmn1r34 A T 6: 66,637,408 F115L probably benign Het
Vnn1 T C 10: 23,895,012 V46A probably benign Het
Xrn1 T A 9: 96,051,736 S1615R probably benign Het
Zfand4 T A 6: 116,285,867 C118S probably damaging Het
Zfp952 G A 17: 33,003,005 E115K possibly damaging Het
Zfpm1 T C 8: 122,335,133 F368L probably damaging Het
Other mutations in Fam160b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fam160b1 APN 19 57381345 missense probably benign 0.00
IGL02642:Fam160b1 APN 19 57385350 missense possibly damaging 0.55
IGL03152:Fam160b1 APN 19 57378832 missense probably damaging 0.99
fredericksburg UTSW 19 57384123 nonsense probably null
R0001:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R0123:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0368:Fam160b1 UTSW 19 57368578 missense possibly damaging 0.91
R0446:Fam160b1 UTSW 19 57381407 missense probably benign 0.00
R0926:Fam160b1 UTSW 19 57381090 missense probably damaging 1.00
R1122:Fam160b1 UTSW 19 57382301 missense probably benign 0.00
R1344:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1398:Fam160b1 UTSW 19 57372926 splice site probably benign
R1418:Fam160b1 UTSW 19 57371162 missense possibly damaging 0.72
R1506:Fam160b1 UTSW 19 57368575 missense probably benign 0.30
R1530:Fam160b1 UTSW 19 57386305 missense probably damaging 0.99
R1695:Fam160b1 UTSW 19 57379171 missense probably damaging 1.00
R1868:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R1974:Fam160b1 UTSW 19 57385377 missense probably damaging 0.99
R2004:Fam160b1 UTSW 19 57381892 missense probably benign
R2893:Fam160b1 UTSW 19 57384169 missense probably benign 0.01
R3011:Fam160b1 UTSW 19 57385288 missense probably damaging 1.00
R3963:Fam160b1 UTSW 19 57373010 missense possibly damaging 0.77
R4416:Fam160b1 UTSW 19 57385397 splice site probably null
R4613:Fam160b1 UTSW 19 57371187 missense probably damaging 0.99
R4735:Fam160b1 UTSW 19 57371229 missense probably damaging 1.00
R4893:Fam160b1 UTSW 19 57381756 missense probably benign 0.01
R4937:Fam160b1 UTSW 19 57378637 missense probably benign
R5049:Fam160b1 UTSW 19 57386305 missense possibly damaging 0.75
R5050:Fam160b1 UTSW 19 57383170 missense probably damaging 1.00
R5080:Fam160b1 UTSW 19 57373281 missense probably damaging 1.00
R5176:Fam160b1 UTSW 19 57371181 missense probably damaging 0.98
R5317:Fam160b1 UTSW 19 57381709 splice site probably null
R5347:Fam160b1 UTSW 19 57378619 missense probably benign
R5497:Fam160b1 UTSW 19 57381151 splice site probably null
R5969:Fam160b1 UTSW 19 57384123 nonsense probably null
R6418:Fam160b1 UTSW 19 57381734 missense probably benign 0.18
R6426:Fam160b1 UTSW 19 57383178 missense probably damaging 1.00
R6765:Fam160b1 UTSW 19 57378745 missense probably benign
R7472:Fam160b1 UTSW 19 57368585 missense probably damaging 1.00
R7583:Fam160b1 UTSW 19 57378602 missense probably benign 0.01
R7672:Fam160b1 UTSW 19 57385318 missense possibly damaging 0.95
X0023:Fam160b1 UTSW 19 57384147 nonsense probably null
X0062:Fam160b1 UTSW 19 57385257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGGACATGACCCTCACAGAGAC -3'
(R):5'- GGTAGGCTCACCAAGAGCATCAAG -3'

Sequencing Primer
(F):5'- AAAGTCCCTGGTGTCCAGAG -3'
(R):5'- GCACACGGAACTTGTCAAATTC -3'
Posted On2013-06-12