Incidental Mutation 'R3112:Plekhh3'
ID 477873
Institutional Source Beutler Lab
Gene Symbol Plekhh3
Ensembl Gene ENSMUSG00000035172
Gene Name pleckstrin homology domain containing, family H (with MyTH4 domain) member 3
Synonyms
MMRRC Submission 040585-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R3112 (G1)
Quality Score 137
Status Not validated
Chromosome 11
Chromosomal Location 101162679-101171351 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) T to C at 101164147 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043397] [ENSMUST00000043654] [ENSMUST00000123864] [ENSMUST00000129895] [ENSMUST00000164474]
AlphaFold Q8VCE9
Predicted Effect unknown
Transcript: ENSMUST00000043397
AA Change: T627A
SMART Domains Protein: ENSMUSP00000046044
Gene: ENSMUSG00000035172
AA Change: T627A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 285 398 4.2e-21 PFAM
B41 400 664 2.91e-4 SMART
low complexity region 750 766 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043654
SMART Domains Protein: ENSMUSP00000045901
Gene: ENSMUSG00000045007

DomainStartEndE-ValueType
Tubulin 48 247 1.11e-58 SMART
Tubulin_C 249 393 4.52e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123864
SMART Domains Protein: ENSMUSP00000120865
Gene: ENSMUSG00000035172

DomainStartEndE-ValueType
PH 95 200 1.9e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129895
AA Change: T627A
SMART Domains Protein: ENSMUSP00000137841
Gene: ENSMUSG00000035172
AA Change: T627A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 2.7e-16 PFAM
B41 400 664 5.17e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139200
AA Change: T241A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156320
Predicted Effect unknown
Transcript: ENSMUST00000164474
AA Change: T624A
SMART Domains Protein: ENSMUSP00000127088
Gene: ENSMUSG00000035172
AA Change: T624A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 23 40 N/A INTRINSIC
PH 96 201 1.9e-5 SMART
low complexity region 241 251 N/A INTRINSIC
Pfam:MyTH4 281 399 3.3e-16 PFAM
B41 400 661 6.14e-4 SMART
low complexity region 747 763 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (38/38)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik T G 2: 111,228,054 L131F probably damaging Het
Abca6 T A 11: 110,178,829 K1554* probably null Het
Acads T C 5: 115,117,698 H26R probably benign Het
Acer1 G A 17: 56,958,406 T141I probably damaging Het
Adam15 C G 3: 89,347,457 V99L probably benign Het
Ankrd13b A G 11: 77,477,505 V97A possibly damaging Het
Anpep T C 7: 79,841,972 T94A probably benign Het
Atp1a3 T C 7: 24,994,694 N345S probably damaging Het
Btn1a1 T A 13: 23,461,551 N216I possibly damaging Het
Cacna1s G A 1: 136,075,093 W62* probably null Het
Ccdc141 C T 2: 77,039,486 V892I probably benign Het
Ccdc180 T A 4: 45,900,470 I278K possibly damaging Het
Cdc7 T G 5: 106,974,698 probably null Het
Cpb1 C T 3: 20,265,357 V188M probably damaging Het
Dock5 A G 14: 67,857,922 I101T possibly damaging Het
Dqx1 T C 6: 83,058,972 V95A probably damaging Het
Dvl1 T A 4: 155,853,666 D90E probably damaging Het
Fam135b T C 15: 71,464,030 I438M probably benign Het
Fam57a A G 11: 76,202,231 D33G probably benign Het
Fpr1 A T 17: 17,876,635 M364K probably benign Het
Gm14139 C G 2: 150,192,221 P185R probably damaging Het
Gm7030 T C 17: 36,129,146 Y32C probably damaging Het
Gpat4 G A 8: 23,180,155 P286L probably damaging Het
Gpx7 C A 4: 108,403,273 V109F probably damaging Het
Grhl2 T C 15: 37,336,347 probably null Het
Grn A G 11: 102,433,243 T53A probably benign Het
Hist1h1e T C 13: 23,621,846 probably benign Het
Hmgxb3 T C 18: 61,147,382 N683S probably damaging Het
Iigp1 T C 18: 60,390,911 I367T probably benign Het
Itfg2 T C 6: 128,411,669 E285G probably damaging Het
Itgav T A 2: 83,792,571 C662* probably null Het
Jarid2 T A 13: 44,906,276 N661K probably damaging Het
Lipe T C 7: 25,398,423 T32A probably benign Het
Lrrk2 A G 15: 91,814,695 Y2475C probably benign Het
Mcc T C 18: 44,449,263 D607G probably damaging Het
Mip T A 10: 128,226,006 L42* probably null Het
Mlc1 A T 15: 88,965,996 D192E probably benign Het
Muc2 T C 7: 141,745,488 probably benign Het
Mybl1 T C 1: 9,681,870 D260G probably damaging Het
Ncln C T 10: 81,487,685 V51I probably benign Het
Nlrp9a T C 7: 26,557,872 V305A probably benign Het
Nodal G A 10: 61,424,497 R309Q possibly damaging Het
Olfr1338 A T 4: 118,754,224 F105I probably damaging Het
Olfr294 T C 7: 86,615,676 Y323C probably benign Het
Olfr536 A G 7: 140,503,919 I180T probably damaging Het
Olr1 T C 6: 129,499,918 N128S possibly damaging Het
Orc1 T A 4: 108,604,560 C585S probably benign Het
Pcmtd2 A T 2: 181,855,129 I300F probably damaging Het
Pfkfb4 C T 9: 109,025,042 probably benign Het
Phactr3 T A 2: 178,279,017 L180Q possibly damaging Het
Pigo T C 4: 43,021,083 T612A probably benign Het
Plch1 T A 3: 63,709,531 D766V probably damaging Het
Ppp1r12b T A 1: 134,872,832 T547S probably damaging Het
Prkcb T A 7: 122,516,856 M186K probably damaging Het
Prpf3 A T 3: 95,849,800 probably benign Het
Psg23 T C 7: 18,610,444 D362G possibly damaging Het
Reg3a T C 6: 78,381,131 L15P probably damaging Het
Scrib A T 15: 76,069,374 I5N probably damaging Het
Speg C T 1: 75,422,682 Q2005* probably null Het
Sppl3 A T 5: 115,074,864 S51C possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Syce1l A G 8: 113,654,947 Q164R probably benign Het
Sympk T C 7: 19,034,484 V126A possibly damaging Het
Tas2r110 T A 6: 132,868,024 I6K unknown Het
Tas2r120 A T 6: 132,657,768 H271L probably damaging Het
Tnn T A 1: 160,116,286 T986S possibly damaging Het
Trim5 T C 7: 104,279,638 H32R probably damaging Het
Ttc13 A G 8: 124,683,834 I360T possibly damaging Het
Uaca A G 9: 60,871,499 E1054G probably damaging Het
Usp16 T A 16: 87,471,848 probably null Het
Wee1 T A 7: 110,130,836 S382R probably damaging Het
Wnt11 T C 7: 98,846,564 S92P probably damaging Het
Zfp786 A G 6: 47,820,226 C593R probably damaging Het
Zfp879 T G 11: 50,833,162 I283L possibly damaging Het
Other mutations in Plekhh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Plekhh3 APN 11 101165693 critical splice acceptor site probably null
R0139:Plekhh3 UTSW 11 101163675 unclassified probably benign
R0385:Plekhh3 UTSW 11 101165141 missense probably damaging 1.00
R0559:Plekhh3 UTSW 11 101164766 missense possibly damaging 0.86
R1839:Plekhh3 UTSW 11 101163600 unclassified probably benign
R2845:Plekhh3 UTSW 11 101170230 intron probably benign
R3110:Plekhh3 UTSW 11 101164147 unclassified probably benign
R3111:Plekhh3 UTSW 11 101164147 unclassified probably benign
R4882:Plekhh3 UTSW 11 101165183 missense probably damaging 0.96
R4882:Plekhh3 UTSW 11 101167938 missense probably null 1.00
R5290:Plekhh3 UTSW 11 101166571 missense possibly damaging 0.61
R5328:Plekhh3 UTSW 11 101167658 intron probably benign
R6008:Plekhh3 UTSW 11 101164765 missense possibly damaging 0.86
R6028:Plekhh3 UTSW 11 101166570 missense probably damaging 1.00
R6156:Plekhh3 UTSW 11 101170187 intron probably benign
R6952:Plekhh3 UTSW 11 101165656 missense probably damaging 1.00
R6994:Plekhh3 UTSW 11 101165693 critical splice acceptor site probably null
R7120:Plekhh3 UTSW 11 101168238 missense probably damaging 0.96
R7324:Plekhh3 UTSW 11 101170774 missense possibly damaging 0.94
R7487:Plekhh3 UTSW 11 101165579 missense possibly damaging 0.94
R7525:Plekhh3 UTSW 11 101166619 missense probably damaging 1.00
R7637:Plekhh3 UTSW 11 101164327 missense unknown
R8345:Plekhh3 UTSW 11 101164279 missense unknown
R8827:Plekhh3 UTSW 11 101167554 missense probably damaging 1.00
R8919:Plekhh3 UTSW 11 101166399 missense probably benign 0.18
R9112:Plekhh3 UTSW 11 101170799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCCCTGGGATAAAGGTGG -3'
(R):5'- AGTTTGCACCGGGACTTTTC -3'

Sequencing Primer
(F):5'- TAAAGGTGGGGGCTTGGACC -3'
(R):5'- TCCTGGACCGCCTGCTG -3'
Posted On 2017-05-15