Incidental Mutation 'R0510:Ubr4'
Institutional Source Beutler Lab
Gene Symbol Ubr4
Ensembl Gene ENSMUSG00000066036
Gene Nameubiquitin protein ligase E3 component n-recognin 4
SynonymsLOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik
MMRRC Submission 038704-MU
Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0510 (G1)
Quality Score155
Status Validated
Chromosomal Location139352609-139489588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 139430223 bp
Amino Acid Change Serine to Alanine at position 2364 (S2364A)
Ref Sequence ENSEMBL: ENSMUSP00000125800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000129779] [ENSMUST00000147999] [ENSMUST00000165860]
Predicted Effect probably benign
Transcript: ENSMUST00000097822
AA Change: S2364A

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: S2364A

low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1660 1725 1.9e-9 PFAM
Blast:ZnF_C2H2 1966 1991 6e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2502 2540 N/A INTRINSIC
low complexity region 2725 2735 N/A INTRINSIC
low complexity region 2818 2852 N/A INTRINSIC
low complexity region 2887 2905 N/A INTRINSIC
low complexity region 2928 2942 N/A INTRINSIC
low complexity region 2945 2959 N/A INTRINSIC
low complexity region 2966 2986 N/A INTRINSIC
low complexity region 3063 3091 N/A INTRINSIC
low complexity region 3329 3385 N/A INTRINSIC
low complexity region 3776 3788 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4364 5160 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129779
Predicted Effect unknown
Transcript: ENSMUST00000129949
AA Change: S1075A
SMART Domains Protein: ENSMUSP00000115711
Gene: ENSMUSG00000066036
AA Change: S1075A

low complexity region 24 42 N/A INTRINSIC
low complexity region 354 367 N/A INTRINSIC
Pfam:zf-UBR 372 437 2.1e-10 PFAM
Blast:ZnF_C2H2 678 703 5e-8 BLAST
low complexity region 980 991 N/A INTRINSIC
low complexity region 1225 1263 N/A INTRINSIC
low complexity region 1448 1458 N/A INTRINSIC
low complexity region 1575 1593 N/A INTRINSIC
low complexity region 1616 1630 N/A INTRINSIC
low complexity region 1633 1647 N/A INTRINSIC
low complexity region 1654 1674 N/A INTRINSIC
low complexity region 1751 1779 N/A INTRINSIC
low complexity region 2017 2045 N/A INTRINSIC
low complexity region 2048 2065 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165860
AA Change: S2364A

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: S2364A

low complexity region 5 20 N/A INTRINSIC
low complexity region 414 425 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
low complexity region 1642 1655 N/A INTRINSIC
Pfam:zf-UBR 1659 1729 4e-13 PFAM
Blast:ZnF_C2H2 1966 1991 5e-8 BLAST
low complexity region 2268 2279 N/A INTRINSIC
low complexity region 2513 2551 N/A INTRINSIC
low complexity region 2736 2746 N/A INTRINSIC
low complexity region 2863 2881 N/A INTRINSIC
low complexity region 2904 2918 N/A INTRINSIC
low complexity region 2921 2935 N/A INTRINSIC
low complexity region 2942 2962 N/A INTRINSIC
low complexity region 3039 3067 N/A INTRINSIC
low complexity region 3305 3361 N/A INTRINSIC
low complexity region 3752 3764 N/A INTRINSIC
Pfam:E3_UbLigase_R4 4340 5136 N/A PFAM
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]
Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Acoxl G A 2: 127,880,503 probably null Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Cdkal1 C A 13: 29,691,596 probably null Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Cpsf1 A T 15: 76,603,657 probably benign Het
Cpsf2 T C 12: 101,988,786 V272A probably damaging Het
Creld2 A T 15: 88,819,956 N50I probably damaging Het
Cyb5r1 T C 1: 134,409,692 probably benign Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dgat1 T C 15: 76,511,567 Y72C possibly damaging Het
Efr3b G T 12: 3,982,058 D183E probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Etfbkmt C T 6: 149,150,584 R96W probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Fat3 C A 9: 15,999,685 E1674* probably null Het
Fbn1 A G 2: 125,342,925 probably benign Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 T A 1: 44,061,097 K280N possibly damaging Het
Gmip C T 8: 69,815,609 probably benign Het
Gpbp1 G T 13: 111,440,745 Q204K possibly damaging Het
Gpr108 T C 17: 57,235,358 D549G possibly damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
H2-Eb2 C T 17: 34,334,244 Q135* probably null Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Hs3st2 T C 7: 121,500,569 S213P probably damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpr2 T C 6: 146,417,979 T188A possibly damaging Het
Kcnh1 T A 1: 192,418,941 probably benign Het
Kctd21 T C 7: 97,347,541 F74L probably damaging Het
Krt23 T A 11: 99,486,782 I133L probably damaging Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lmtk3 T A 7: 45,794,112 L740M possibly damaging Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map1a A T 2: 121,305,774 H2357L probably benign Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtss1 A T 15: 58,956,538 D175E probably benign Het
Myef2 A T 2: 125,109,034 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr1138 A G 2: 87,737,481 V281A probably damaging Het
Olfr1238 A T 2: 89,406,791 M96K probably damaging Het
Olfr305 T C 7: 86,363,827 N170S probably benign Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Pim1 T C 17: 29,493,909 probably benign Het
Pou6f2 A G 13: 18,139,723 probably benign Het
Prelid3b A G 2: 174,465,950 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Rab3gap2 T C 1: 185,260,508 probably benign Het
Rb1cc1 A C 1: 6,249,171 K938T probably benign Het
Rem2 T C 14: 54,476,297 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rps6ka4 G T 19: 6,840,498 T17N probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ruvbl2 C T 7: 45,431,306 probably benign Het
Scaper A G 9: 55,758,062 probably benign Het
Sdc2 T C 15: 33,017,089 probably benign Het
Slc35e1 T C 8: 72,492,571 probably benign Het
Slco2b1 T A 7: 99,661,536 M603L probably benign Het
Smpdl3b A G 4: 132,745,138 V108A probably damaging Het
Sptbn4 C T 7: 27,361,566 probably null Het
Srrm1 G A 4: 135,338,543 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Sv2b T G 7: 75,136,392 M427L probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 T C 12: 75,854,149 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Trpm1 G A 7: 64,223,758 G587D probably damaging Het
Ttn A G 2: 76,730,412 V29215A probably damaging Het
Ush2a T A 1: 188,734,663 probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r57 A T 7: 41,427,792 S317T possibly damaging Het
Vwa2 A G 19: 56,898,068 probably benign Het
Wdr73 G A 7: 80,897,950 Q107* probably null Het
Zbtb10 T A 3: 9,264,668 V362E probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp296 A T 7: 19,577,906 M113L probably benign Het
Zfp729b A T 13: 67,591,134 V1004E probably benign Het
Other mutations in Ubr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ubr4 APN 4 139465322 missense possibly damaging 0.46
IGL00336:Ubr4 APN 4 139428566 missense probably damaging 1.00
IGL00586:Ubr4 APN 4 139455184 missense possibly damaging 0.95
IGL00659:Ubr4 APN 4 139421245 missense probably damaging 1.00
IGL00766:Ubr4 APN 4 139440766 missense probably damaging 1.00
IGL00819:Ubr4 APN 4 139476282 missense possibly damaging 0.92
IGL00833:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL01126:Ubr4 APN 4 139402555 missense probably benign 0.04
IGL01311:Ubr4 APN 4 139479045 missense possibly damaging 0.66
IGL01349:Ubr4 APN 4 139480728 missense unknown
IGL01388:Ubr4 APN 4 139460243 missense possibly damaging 0.76
IGL01417:Ubr4 APN 4 139410800 missense probably damaging 0.99
IGL01446:Ubr4 APN 4 139438040 splice site probably benign
IGL01449:Ubr4 APN 4 139412736 missense probably damaging 0.98
IGL01545:Ubr4 APN 4 139442829 splice site probably benign
IGL01568:Ubr4 APN 4 139421373 missense probably damaging 1.00
IGL01596:Ubr4 APN 4 139462534 splice site probably benign
IGL01621:Ubr4 APN 4 139440783 nonsense probably null
IGL01639:Ubr4 APN 4 139417344 missense probably damaging 0.99
IGL01655:Ubr4 APN 4 139407796 missense probably damaging 1.00
IGL01710:Ubr4 APN 4 139418461 missense possibly damaging 0.81
IGL01830:Ubr4 APN 4 139472500 missense probably damaging 0.99
IGL01862:Ubr4 APN 4 139477158 missense possibly damaging 0.66
IGL01868:Ubr4 APN 4 139412678 nonsense probably null
IGL01874:Ubr4 APN 4 139393289 splice site probably benign
IGL01889:Ubr4 APN 4 139462472 nonsense probably null
IGL01891:Ubr4 APN 4 139436260 critical splice donor site probably null
IGL01980:Ubr4 APN 4 139429602 missense probably damaging 0.99
IGL02126:Ubr4 APN 4 139452741 critical splice donor site probably null
IGL02153:Ubr4 APN 4 139460160 nonsense probably null
IGL02173:Ubr4 APN 4 139437070 splice site probably null
IGL02214:Ubr4 APN 4 139428583 missense possibly damaging 0.95
IGL02214:Ubr4 APN 4 139461827 critical splice acceptor site probably null
IGL02220:Ubr4 APN 4 139388435 missense probably benign 0.01
IGL02246:Ubr4 APN 4 139459103 missense possibly damaging 0.89
IGL02264:Ubr4 APN 4 139455628 nonsense probably null
IGL02273:Ubr4 APN 4 139472578 missense possibly damaging 0.94
IGL02316:Ubr4 APN 4 139473178 missense possibly damaging 0.46
IGL02328:Ubr4 APN 4 139478922 missense probably damaging 0.97
IGL02476:Ubr4 APN 4 139421249 nonsense probably null
IGL02477:Ubr4 APN 4 139436205 missense probably damaging 0.98
IGL02544:Ubr4 APN 4 139415118 missense probably damaging 1.00
IGL02622:Ubr4 APN 4 139467250 nonsense probably null
IGL02679:Ubr4 APN 4 139459134 missense probably damaging 0.99
IGL02728:Ubr4 APN 4 139468811 missense probably damaging 1.00
IGL02754:Ubr4 APN 4 139410784 missense probably damaging 0.99
IGL02754:Ubr4 APN 4 139393159 critical splice donor site probably null
IGL02892:Ubr4 APN 4 139417331 missense probably damaging 0.96
IGL02897:Ubr4 APN 4 139472508 missense probably damaging 0.97
IGL02946:Ubr4 APN 4 139425295 missense probably damaging 1.00
IGL02964:Ubr4 APN 4 139407820 missense possibly damaging 0.84
IGL03059:Ubr4 APN 4 139480676 missense probably damaging 0.98
IGL03068:Ubr4 APN 4 139409730 missense probably benign 0.02
IGL03087:Ubr4 APN 4 139450357 nonsense probably null
IGL03116:Ubr4 APN 4 139479581 splice site probably benign
IGL03212:Ubr4 APN 4 139409763 missense probably benign 0.13
IGL03228:Ubr4 APN 4 139429598 missense probably damaging 1.00
IGL03292:Ubr4 APN 4 139440435 missense probably damaging 1.00
IGL03388:Ubr4 APN 4 139415032 missense probably damaging 0.98
IGL03393:Ubr4 APN 4 139452678 missense probably damaging 1.00
IGL03409:Ubr4 APN 4 139399929 nonsense probably null
Aqua_regia UTSW 4 139452719 nonsense probably null
Hardened UTSW 4 139468847 missense probably damaging 1.00
Stoney UTSW 4 139444687 missense probably damaging 1.00
BB001:Ubr4 UTSW 4 139467276 missense unknown
BB011:Ubr4 UTSW 4 139467276 missense unknown
P0019:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
PIT4544001:Ubr4 UTSW 4 139402560 missense possibly damaging 0.93
R0001:Ubr4 UTSW 4 139451788 missense probably damaging 1.00
R0002:Ubr4 UTSW 4 139390900 missense probably damaging 1.00
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0006:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0008:Ubr4 UTSW 4 139430176 missense probably damaging 1.00
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0027:Ubr4 UTSW 4 139400393 missense probably damaging 0.99
R0030:Ubr4 UTSW 4 139426793 missense probably damaging 1.00
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0044:Ubr4 UTSW 4 139437058 splice site probably benign
R0088:Ubr4 UTSW 4 139440814 missense probably damaging 1.00
R0131:Ubr4 UTSW 4 139464051 missense possibly damaging 0.66
R0184:Ubr4 UTSW 4 139445262 missense probably damaging 1.00
R0219:Ubr4 UTSW 4 139430257 missense possibly damaging 0.64
R0227:Ubr4 UTSW 4 139431649 missense probably benign 0.03
R0270:Ubr4 UTSW 4 139479435 splice site probably benign
R0285:Ubr4 UTSW 4 139440801 missense probably damaging 1.00
R0322:Ubr4 UTSW 4 139422418 missense probably damaging 1.00
R0363:Ubr4 UTSW 4 139391860 missense probably damaging 0.98
R0393:Ubr4 UTSW 4 139410860 splice site probably benign
R0450:Ubr4 UTSW 4 139430223 missense probably benign 0.14
R0504:Ubr4 UTSW 4 139406578 missense probably damaging 1.00
R0504:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R0513:Ubr4 UTSW 4 139416875 missense possibly damaging 0.74
R0517:Ubr4 UTSW 4 139392124 missense probably benign 0.00
R0558:Ubr4 UTSW 4 139426902 missense probably benign 0.09
R0617:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R0636:Ubr4 UTSW 4 139436302 splice site probably null
R0637:Ubr4 UTSW 4 139399615 missense probably damaging 1.00
R0652:Ubr4 UTSW 4 139401326 missense probably damaging 0.99
R0691:Ubr4 UTSW 4 139423906 missense probably damaging 1.00
R0729:Ubr4 UTSW 4 139485320 missense possibly damaging 0.66
R0735:Ubr4 UTSW 4 139428028 splice site probably null
R0751:Ubr4 UTSW 4 139437198 splice site probably benign
R0789:Ubr4 UTSW 4 139410271 critical splice donor site probably null
R0825:Ubr4 UTSW 4 139479576 critical splice donor site probably null
R0828:Ubr4 UTSW 4 139450553 splice site probably benign
R1052:Ubr4 UTSW 4 139455460 missense possibly damaging 0.83
R1184:Ubr4 UTSW 4 139437198 splice site probably benign
R1222:Ubr4 UTSW 4 139388471 splice site probably null
R1258:Ubr4 UTSW 4 139426914 missense probably damaging 1.00
R1321:Ubr4 UTSW 4 139460123 missense possibly damaging 0.46
R1385:Ubr4 UTSW 4 139402612 missense probably benign 0.00
R1450:Ubr4 UTSW 4 139468028 missense probably damaging 1.00
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1470:Ubr4 UTSW 4 139421226 splice site probably null
R1474:Ubr4 UTSW 4 139429579 missense probably damaging 1.00
R1479:Ubr4 UTSW 4 139425840 missense possibly damaging 0.95
R1534:Ubr4 UTSW 4 139428151 missense possibly damaging 0.95
R1546:Ubr4 UTSW 4 139416927 nonsense probably null
R1785:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1786:Ubr4 UTSW 4 139423945 missense probably damaging 1.00
R1789:Ubr4 UTSW 4 139393053 missense probably damaging 1.00
R1796:Ubr4 UTSW 4 139428596 missense probably benign 0.25
R1800:Ubr4 UTSW 4 139407963 missense probably damaging 0.99
R1801:Ubr4 UTSW 4 139452563 splice site probably null
R1827:Ubr4 UTSW 4 139425697 critical splice acceptor site probably null
R1887:Ubr4 UTSW 4 139455560 missense probably damaging 1.00
R1966:Ubr4 UTSW 4 139451244 critical splice acceptor site probably null
R2010:Ubr4 UTSW 4 139480652 missense possibly damaging 0.92
R2049:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2069:Ubr4 UTSW 4 139479540 missense possibly damaging 0.66
R2114:Ubr4 UTSW 4 139429611 nonsense probably null
R2140:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2141:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2142:Ubr4 UTSW 4 139477207 missense probably damaging 0.97
R2168:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R2237:Ubr4 UTSW 4 139442790 missense probably damaging 1.00
R2249:Ubr4 UTSW 4 139448921 missense probably damaging 1.00
R2261:Ubr4 UTSW 4 139413462 missense probably damaging 0.99
R2264:Ubr4 UTSW 4 139420373 splice site probably benign
R2353:Ubr4 UTSW 4 139433673 missense possibly damaging 0.48
R2437:Ubr4 UTSW 4 139473542 missense possibly damaging 0.90
R2496:Ubr4 UTSW 4 139473205 unclassified probably benign
R2896:Ubr4 UTSW 4 139455644 splice site probably null
R2922:Ubr4 UTSW 4 139479500 missense possibly damaging 0.66
R2972:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2973:Ubr4 UTSW 4 139406536 missense probably benign 0.22
R2989:Ubr4 UTSW 4 139463558 missense possibly damaging 0.89
R3176:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3276:Ubr4 UTSW 4 139421855 missense probably benign 0.03
R3772:Ubr4 UTSW 4 139452700 missense possibly damaging 0.89
R3844:Ubr4 UTSW 4 139459126 missense probably damaging 0.99
R3873:Ubr4 UTSW 4 139423990 missense probably damaging 1.00
R3900:Ubr4 UTSW 4 139479062 critical splice donor site probably null
R3951:Ubr4 UTSW 4 139393094 missense probably damaging 1.00
R4020:Ubr4 UTSW 4 139451805 missense probably damaging 0.98
R4178:Ubr4 UTSW 4 139393414 missense probably damaging 1.00
R4308:Ubr4 UTSW 4 139472509 missense possibly damaging 0.46
R4378:Ubr4 UTSW 4 139410440 missense possibly damaging 0.76
R4400:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4421:Ubr4 UTSW 4 139461856 missense possibly damaging 0.66
R4462:Ubr4 UTSW 4 139418502 missense possibly damaging 0.47
R4583:Ubr4 UTSW 4 139380853 missense possibly damaging 0.82
R4611:Ubr4 UTSW 4 139399579 missense possibly damaging 0.93
R4664:Ubr4 UTSW 4 139406518 missense possibly damaging 0.56
R4671:Ubr4 UTSW 4 139436191 missense possibly damaging 0.66
R4672:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4673:Ubr4 UTSW 4 139410716 missense probably damaging 0.99
R4696:Ubr4 UTSW 4 139408672 missense probably benign 0.09
R4701:Ubr4 UTSW 4 139471336 missense possibly damaging 0.66
R4705:Ubr4 UTSW 4 139450529 missense probably damaging 1.00
R4726:Ubr4 UTSW 4 139482579 missense possibly damaging 0.46
R4728:Ubr4 UTSW 4 139423879 missense probably damaging 1.00
R4783:Ubr4 UTSW 4 139421733 missense possibly damaging 0.85
R4833:Ubr4 UTSW 4 139402546 missense probably damaging 0.98
R4892:Ubr4 UTSW 4 139428517 missense probably benign 0.14
R4936:Ubr4 UTSW 4 139396566 missense probably damaging 0.98
R5000:Ubr4 UTSW 4 139436169 missense probably damaging 0.98
R5114:Ubr4 UTSW 4 139410623 missense probably damaging 0.99
R5189:Ubr4 UTSW 4 139410649 missense probably benign 0.25
R5197:Ubr4 UTSW 4 139468097 missense probably damaging 1.00
R5213:Ubr4 UTSW 4 139402566 nonsense probably null
R5219:Ubr4 UTSW 4 139477232 nonsense probably null
R5346:Ubr4 UTSW 4 139428491 missense probably damaging 0.97
R5368:Ubr4 UTSW 4 139397528 intron probably benign
R5442:Ubr4 UTSW 4 139407772 missense probably damaging 1.00
R5527:Ubr4 UTSW 4 139480788 missense possibly damaging 0.83
R5548:Ubr4 UTSW 4 139460090 missense probably damaging 0.97
R5568:Ubr4 UTSW 4 139392038 missense probably damaging 0.99
R5639:Ubr4 UTSW 4 139452648 missense possibly damaging 0.66
R5643:Ubr4 UTSW 4 139444687 missense probably damaging 1.00
R5663:Ubr4 UTSW 4 139428583 missense possibly damaging 0.95
R5755:Ubr4 UTSW 4 139460095 missense possibly damaging 0.66
R5781:Ubr4 UTSW 4 139468096 missense probably damaging 1.00
R5784:Ubr4 UTSW 4 139425218 missense probably damaging 1.00
R5817:Ubr4 UTSW 4 139468847 missense probably damaging 1.00
R5872:Ubr4 UTSW 4 139425330 missense probably damaging 0.98
R5891:Ubr4 UTSW 4 139408626 nonsense probably null
R5901:Ubr4 UTSW 4 139451254 missense probably damaging 1.00
R5958:Ubr4 UTSW 4 139455638 missense probably damaging 1.00
R5974:Ubr4 UTSW 4 139421078 splice site probably null
R6065:Ubr4 UTSW 4 139421238 missense probably damaging 1.00
R6109:Ubr4 UTSW 4 139417364 missense probably damaging 0.99
R6207:Ubr4 UTSW 4 139421248 missense probably damaging 1.00
R6265:Ubr4 UTSW 4 139452640 missense possibly damaging 0.90
R6319:Ubr4 UTSW 4 139408889 missense possibly damaging 0.84
R6342:Ubr4 UTSW 4 139429539 missense possibly damaging 0.88
R6434:Ubr4 UTSW 4 139429638 missense probably damaging 1.00
R6437:Ubr4 UTSW 4 139397214 critical splice donor site probably null
R6481:Ubr4 UTSW 4 139431751 missense probably damaging 0.97
R6502:Ubr4 UTSW 4 139444671 missense probably damaging 1.00
R6546:Ubr4 UTSW 4 139414394 missense probably damaging 0.99
R6603:Ubr4 UTSW 4 139455586 missense probably benign 0.17
R6648:Ubr4 UTSW 4 139452719 nonsense probably null
R6649:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6653:Ubr4 UTSW 4 139473624 missense possibly damaging 0.66
R6668:Ubr4 UTSW 4 139465341 missense probably damaging 1.00
R6770:Ubr4 UTSW 4 139489182 missense unknown
R6772:Ubr4 UTSW 4 139467230 nonsense probably null
R6857:Ubr4 UTSW 4 139486051 missense possibly damaging 0.90
R6869:Ubr4 UTSW 4 139467227 missense possibly damaging 0.93
R6912:Ubr4 UTSW 4 139458234 critical splice donor site probably null
R6943:Ubr4 UTSW 4 139437131 nonsense probably null
R6970:Ubr4 UTSW 4 139406528 nonsense probably null
R6976:Ubr4 UTSW 4 139393077 missense probably damaging 0.98
R7000:Ubr4 UTSW 4 139414404 missense probably damaging 1.00
R7017:Ubr4 UTSW 4 139393090 missense probably damaging 0.99
R7165:Ubr4 UTSW 4 139450513 missense
R7222:Ubr4 UTSW 4 139463373 missense unknown
R7241:Ubr4 UTSW 4 139443414 missense probably damaging 1.00
R7343:Ubr4 UTSW 4 139413438 missense probably benign 0.09
R7367:Ubr4 UTSW 4 139452691 missense unknown
R7393:Ubr4 UTSW 4 139426785 missense probably damaging 1.00
R7432:Ubr4 UTSW 4 139388382 missense probably damaging 1.00
R7448:Ubr4 UTSW 4 139462467 missense unknown
R7502:Ubr4 UTSW 4 139412672 missense possibly damaging 0.72
R7514:Ubr4 UTSW 4 139452655 missense unknown
R7526:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7529:Ubr4 UTSW 4 139422417 missense probably benign 0.00
R7666:Ubr4 UTSW 4 139413480 missense possibly damaging 0.81
R7699:Ubr4 UTSW 4 139408867 nonsense probably null
R7700:Ubr4 UTSW 4 139408867 nonsense probably null
R7726:Ubr4 UTSW 4 139458920 missense unknown
R7753:Ubr4 UTSW 4 139470292 missense unknown
R7810:Ubr4 UTSW 4 139415083 missense
R7837:Ubr4 UTSW 4 139393151 nonsense probably null
R7868:Ubr4 UTSW 4 139460033 missense unknown
R7872:Ubr4 UTSW 4 139393062 missense possibly damaging 0.94
R7887:Ubr4 UTSW 4 139407810 missense probably damaging 0.99
R7924:Ubr4 UTSW 4 139467276 missense unknown
R7980:Ubr4 UTSW 4 139418406 missense
R7982:Ubr4 UTSW 4 139428208 critical splice donor site probably null
R8005:Ubr4 UTSW 4 139412630 missense probably damaging 0.98
R8054:Ubr4 UTSW 4 139468102 missense unknown
R8094:Ubr4 UTSW 4 139440696 missense probably damaging 0.97
R8151:Ubr4 UTSW 4 139402801 missense probably damaging 0.97
R8183:Ubr4 UTSW 4 139482471 missense unknown
R8252:Ubr4 UTSW 4 139473217 missense unknown
R8505:Ubr4 UTSW 4 139429569 missense
R8519:Ubr4 UTSW 4 139416647 missense probably damaging 0.97
R8716:Ubr4 UTSW 4 139468853 missense unknown
R8720:Ubr4 UTSW 4 139480838 critical splice donor site probably null
R8749:Ubr4 UTSW 4 139402624 missense probably damaging 0.98
R8768:Ubr4 UTSW 4 139421765 missense
R8789:Ubr4 UTSW 4 139410183 missense possibly damaging 0.76
R8879:Ubr4 UTSW 4 139410518 missense probably benign 0.06
R8937:Ubr4 UTSW 4 139463575 missense probably damaging 0.97
T0975:Ubr4 UTSW 4 139451781 missense probably damaging 1.00
X0028:Ubr4 UTSW 4 139410271 critical splice donor site probably null
Z1176:Ubr4 UTSW 4 139400385 missense probably damaging 1.00
Z1176:Ubr4 UTSW 4 139402660 missense probably benign 0.04
Z1176:Ubr4 UTSW 4 139410145 missense probably damaging 1.00
Z1177:Ubr4 UTSW 4 139450481 missense
Z1186:Ubr4 UTSW 4 139410653 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacgattaggatggagttcaaag -3'
Posted On2013-06-12