Incidental Mutation 'R0510:Abcg3'
ID 47791
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 038704-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R0510 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 105125482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 67 (I67T)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably damaging
Transcript: ENSMUST00000031239
AA Change: I67T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: I67T

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130644
AA Change: I67T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299
AA Change: I67T

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Meta Mutation Damage Score 0.6580 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl G A 2: 127,722,423 (GRCm39) probably null Het
Adam10 T A 9: 70,655,530 (GRCm39) W333R probably damaging Het
Ahnak C T 19: 8,995,596 (GRCm39) R5627* probably null Het
Alms1 A T 6: 85,597,351 (GRCm39) R1195* probably null Het
Ap2m1 T A 16: 20,360,990 (GRCm39) I334N possibly damaging Het
Brd8dc A T 18: 34,729,204 (GRCm39) D42E probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc110 T A 8: 46,388,194 (GRCm39) N50K probably benign Het
Ccdc168 T A 1: 44,100,257 (GRCm39) K280N possibly damaging Het
Cdhr1 T C 14: 36,802,633 (GRCm39) Y610C probably damaging Het
Cdkal1 C A 13: 29,875,579 (GRCm39) probably null Het
Celsr3 G A 9: 108,704,204 (GRCm39) C229Y possibly damaging Het
Clca4b A T 3: 144,619,112 (GRCm39) Y676N probably damaging Het
Col11a1 A T 3: 113,899,105 (GRCm39) probably benign Het
Cpe T A 8: 65,064,501 (GRCm39) I233F probably damaging Het
Cpsf1 A T 15: 76,487,857 (GRCm39) probably benign Het
Cpsf2 T C 12: 101,955,045 (GRCm39) V272A probably damaging Het
Creld2 A T 15: 88,704,159 (GRCm39) N50I probably damaging Het
Cyb5r1 T C 1: 134,337,430 (GRCm39) probably benign Het
Dcaf11 T C 14: 55,806,537 (GRCm39) V446A probably damaging Het
Defa34 A G 8: 22,155,988 (GRCm39) probably null Het
Dgat1 T C 15: 76,395,767 (GRCm39) Y72C possibly damaging Het
Efr3b G T 12: 4,032,058 (GRCm39) D183E probably benign Het
Enpp3 A T 10: 24,652,679 (GRCm39) D759E probably damaging Het
Epyc A G 10: 97,485,625 (GRCm39) T22A probably benign Het
Etfbkmt C T 6: 149,052,082 (GRCm39) R96W probably benign Het
Fam83b G T 9: 76,400,108 (GRCm39) L332I possibly damaging Het
Fat3 C A 9: 15,910,981 (GRCm39) E1674* probably null Het
Fbn1 A G 2: 125,184,845 (GRCm39) probably benign Het
Gm5134 C A 10: 75,810,079 (GRCm39) T120N probably benign Het
Gmip C T 8: 70,268,259 (GRCm39) probably benign Het
Gpbp1 G T 13: 111,577,279 (GRCm39) Q204K possibly damaging Het
Gpr108 T C 17: 57,542,358 (GRCm39) D549G possibly damaging Het
Gsdme C A 6: 50,223,107 (GRCm39) probably benign Het
Gucy2e T C 11: 69,126,402 (GRCm39) D326G probably benign Het
H2-Eb2 C T 17: 34,553,218 (GRCm39) Q135* probably null Het
Hectd4 G A 5: 121,443,736 (GRCm39) E1319K possibly damaging Het
Hectd4 T A 5: 121,419,959 (GRCm39) Y635N possibly damaging Het
Hs3st2 T C 7: 121,099,792 (GRCm39) S213P probably damaging Het
Ikbkb A T 8: 23,161,651 (GRCm39) C412* probably null Het
Itpr2 T C 6: 146,319,477 (GRCm39) T188A possibly damaging Het
Kcnh1 T A 1: 192,101,249 (GRCm39) probably benign Het
Kctd21 T C 7: 96,996,748 (GRCm39) F74L probably damaging Het
Krt23 T A 11: 99,377,608 (GRCm39) I133L probably damaging Het
Krt74 T C 15: 101,671,751 (GRCm39) noncoding transcript Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lmtk3 T A 7: 45,443,536 (GRCm39) L740M possibly damaging Het
Lrrc10 T A 10: 116,881,695 (GRCm39) L123Q probably damaging Het
Map1a A T 2: 121,136,255 (GRCm39) H2357L probably benign Het
Mbl1 A G 14: 40,880,706 (GRCm39) N198S probably damaging Het
Mcf2l A G 8: 13,047,337 (GRCm39) D233G probably damaging Het
Msto1 A G 3: 88,818,848 (GRCm39) L269P probably benign Het
Mtss1 A T 15: 58,828,387 (GRCm39) D175E probably benign Het
Myef2 A T 2: 124,950,954 (GRCm39) probably benign Het
Neb A T 2: 52,180,755 (GRCm39) probably benign Het
Or14a259 T C 7: 86,013,035 (GRCm39) N170S probably benign Het
Or4a39 A T 2: 89,237,135 (GRCm39) M96K probably damaging Het
Or5w15 A G 2: 87,567,825 (GRCm39) V281A probably damaging Het
Parp2 T A 14: 51,057,130 (GRCm39) Y361N probably damaging Het
Parp3 A G 9: 106,348,995 (GRCm39) F466L possibly damaging Het
Pcdh15 A T 10: 74,126,808 (GRCm39) N296Y probably damaging Het
Pdzrn3 A T 6: 101,128,014 (GRCm39) I884N probably damaging Het
Pim1 T C 17: 29,712,883 (GRCm39) probably benign Het
Pou6f2 A G 13: 18,314,308 (GRCm39) probably benign Het
Prelid3b A G 2: 174,307,743 (GRCm39) probably benign Het
Proc G A 18: 32,258,171 (GRCm39) T258I probably benign Het
Rab3gap2 T C 1: 184,992,705 (GRCm39) probably benign Het
Rb1cc1 A C 1: 6,319,395 (GRCm39) K938T probably benign Het
Rem2 T C 14: 54,713,754 (GRCm39) probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rin2 A G 2: 145,702,953 (GRCm39) K550E probably benign Het
Rps6ka4 G T 19: 6,817,866 (GRCm39) T17N probably benign Het
Rtn4 T A 11: 29,683,849 (GRCm39) probably benign Het
Ruvbl2 C T 7: 45,080,730 (GRCm39) probably benign Het
Scaper A G 9: 55,665,346 (GRCm39) probably benign Het
Sdc2 T C 15: 33,017,235 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,584,956 (GRCm39) N318I possibly damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slco2b1 T A 7: 99,310,743 (GRCm39) M603L probably benign Het
Smpdl3b A G 4: 132,472,449 (GRCm39) V108A probably damaging Het
Sptbn4 C T 7: 27,060,991 (GRCm39) probably null Het
Srrm1 G A 4: 135,065,854 (GRCm39) probably benign Het
Ssh1 A T 5: 114,084,766 (GRCm39) D448E probably benign Het
Ssmem1 A T 6: 30,519,547 (GRCm39) probably null Het
Sv2b T G 7: 74,786,140 (GRCm39) M427L probably benign Het
Syne1 A G 10: 5,317,600 (GRCm39) L498P probably damaging Het
Syne2 T C 12: 75,900,923 (GRCm39) probably null Het
Taf6l G T 19: 8,755,885 (GRCm39) H254Q probably benign Het
Traf3ip3 T A 1: 192,860,539 (GRCm39) probably null Het
Trpm1 G A 7: 63,873,506 (GRCm39) G587D probably damaging Het
Ttn A G 2: 76,560,756 (GRCm39) V29215A probably damaging Het
Ubr4 T G 4: 139,157,534 (GRCm39) S2364A probably benign Het
Ush2a T A 1: 188,466,860 (GRCm39) probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r57 A T 7: 41,077,216 (GRCm39) S317T possibly damaging Het
Vwa2 A G 19: 56,886,500 (GRCm39) probably benign Het
Wdr73 G A 7: 80,547,698 (GRCm39) Q107* probably null Het
Zbtb10 T A 3: 9,329,728 (GRCm39) V362E probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp296 A T 7: 19,311,831 (GRCm39) M113L probably benign Het
Zfp729b A T 13: 67,739,253 (GRCm39) V1004E probably benign Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7728:Abcg3 UTSW 5 105,083,944 (GRCm39) missense probably benign 0.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGATTGATGGGGAAGCACTTGATA -3'
(R):5'- CTTTGTGACCTTCCTGAAACAAACACC -3'

Sequencing Primer
(F):5'- ccacacacatacacacacataaac -3'
(R):5'- CCAGTGACCTGAAGACATTGAC -3'
Posted On 2013-06-12