Mutagenetix > Incidental Mutation

Incidental Mutation 'R0510:Alms1'

47797

Institutional Source

Beutler Lab

Gene Symbol

Alms1

Ensembl Gene

ENSMUSG00000063810

Gene Name

ALMS1, centrosome and basal body associated

Synonyms

MMRRC Submission

038704-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0510 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85587531-85702753 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 85620369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1195 (R1195*)

Ref Sequence

ENSEMBL: ENSMUSP00000148796 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000072018
AA Change: R726*

SMART Domains

Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: R726*

Domain	Start	End	E-Value	Type
coiled coil region	10	39	N/A	INTRINSIC
low complexity region	67	80	N/A	INTRINSIC
low complexity region	98	119	N/A	INTRINSIC
Blast:MYSc	127	233	1e-21	BLAST
internal_repeat_3	408	511	2.48e-7	PROSPERO
internal_repeat_2	414	804	2.09e-12	PROSPERO
internal_repeat_1	438	834	4.54e-18	PROSPERO
internal_repeat_3	652	757	2.48e-7	PROSPERO
low complexity region	903	908	N/A	INTRINSIC
internal_repeat_1	916	1385	4.54e-18	PROSPERO
internal_repeat_2	1024	1390	2.09e-12	PROSPERO
low complexity region	1572	1586	N/A	INTRINSIC
low complexity region	2004	2017	N/A	INTRINSIC
low complexity region	2760	2773	N/A	INTRINSIC
low complexity region	2950	2968	N/A	INTRINSIC
low complexity region	3013	3030	N/A	INTRINSIC
Pfam:ALMS_motif	3125	3247	1.8e-42	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000213058
AA Change: R1195*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

99% (102/103)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933408B17Rik	A	T	18: 34,596,151	D42E	probably damaging	Het
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Acoxl	G	A	2: 127,880,503		probably null	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Cdkal1	C	A	13: 29,691,596		probably null	Het
Celsr3	G	A	9: 108,827,005	C229Y	possibly damaging	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Col11a1	A	T	3: 114,105,456		probably benign	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Cpsf1	A	T	15: 76,603,657		probably benign	Het
Cpsf2	T	C	12: 101,988,786	V272A	probably damaging	Het
Creld2	A	T	15: 88,819,956	N50I	probably damaging	Het
Cyb5r1	T	C	1: 134,409,692		probably benign	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dgat1	T	C	15: 76,511,567	Y72C	possibly damaging	Het
Efr3b	G	T	12: 3,982,058	D183E	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Etfbkmt	C	T	6: 149,150,584	R96W	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Fat3	C	A	9: 15,999,685	E1674*	probably null	Het
Fbn1	A	G	2: 125,342,925		probably benign	Het
Gm5134	C	A	10: 75,974,245	T120N	probably benign	Het
Gm5415	T	A	1: 32,545,875	N318I	possibly damaging	Het
Gm8251	T	A	1: 44,061,097	K280N	possibly damaging	Het
Gmip	C	T	8: 69,815,609		probably benign	Het
Gpbp1	G	T	13: 111,440,745	Q204K	possibly damaging	Het
Gpr108	T	C	17: 57,235,358	D549G	possibly damaging	Het
Gsdme	C	A	6: 50,246,127		probably benign	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
H2-Eb2	C	T	17: 34,334,244	Q135*	probably null	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Hs3st2	T	C	7: 121,500,569	S213P	probably damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Itpr2	T	C	6: 146,417,979	T188A	possibly damaging	Het
Kcnh1	T	A	1: 192,418,941		probably benign	Het
Kctd21	T	C	7: 97,347,541	F74L	probably damaging	Het
Krt23	T	A	11: 99,486,782	I133L	probably damaging	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lmtk3	T	A	7: 45,794,112	L740M	possibly damaging	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map1a	A	T	2: 121,305,774	H2357L	probably benign	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Mtss1	A	T	15: 58,956,538	D175E	probably benign	Het
Myef2	A	T	2: 125,109,034		probably benign	Het
Neb	A	T	2: 52,290,743		probably benign	Het
Olfr1138	A	G	2: 87,737,481	V281A	probably damaging	Het
Olfr1238	A	T	2: 89,406,791	M96K	probably damaging	Het
Olfr305	T	C	7: 86,363,827	N170S	probably benign	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Parp3	A	G	9: 106,471,796	F466L	possibly damaging	Het
Pcdh15	A	T	10: 74,290,976	N296Y	probably damaging	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Pim1	T	C	17: 29,493,909		probably benign	Het
Pou6f2	A	G	13: 18,139,723		probably benign	Het
Prelid3b	A	G	2: 174,465,950		probably benign	Het
Proc	G	A	18: 32,125,118	T258I	probably benign	Het
Rab3gap2	T	C	1: 185,260,508		probably benign	Het
Rb1cc1	A	C	1: 6,249,171	K938T	probably benign	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rin2	A	G	2: 145,861,033	K550E	probably benign	Het
Rps6ka4	G	T	19: 6,840,498	T17N	probably benign	Het
Rtn4	T	A	11: 29,733,849		probably benign	Het
Ruvbl2	C	T	7: 45,431,306		probably benign	Het
Scaper	A	G	9: 55,758,062		probably benign	Het
Sdc2	T	C	15: 33,017,089		probably benign	Het
Slc35e1	T	C	8: 72,492,571		probably benign	Het
Slco2b1	T	A	7: 99,661,536	M603L	probably benign	Het
Smpdl3b	A	G	4: 132,745,138	V108A	probably damaging	Het
Sptbn4	C	T	7: 27,361,566		probably null	Het
Srrm1	G	A	4: 135,338,543		probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Sv2b	T	G	7: 75,136,392	M427L	probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	T	C	12: 75,854,149		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Trpm1	G	A	7: 64,223,758	G587D	probably damaging	Het
Ttn	A	G	2: 76,730,412	V29215A	probably damaging	Het
Ubr4	T	G	4: 139,430,223	S2364A	probably benign	Het
Ush2a	T	A	1: 188,734,663		probably benign	Het
Vmn2r100	C	A	17: 19,522,120	P252Q	possibly damaging	Het
Vmn2r57	A	T	7: 41,427,792	S317T	possibly damaging	Het
Vwa2	A	G	19: 56,898,068		probably benign	Het
Wdr73	G	A	7: 80,897,950	Q107*	probably null	Het
Zbtb10	T	A	3: 9,264,668	V362E	probably damaging	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp296	A	T	7: 19,577,906	M113L	probably benign	Het
Zfp729b	A	T	13: 67,591,134	V1004E	probably benign	Het

Other mutations in Alms1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Alms1	APN	6	85677964	missense	probably damaging	1.00
IGL00331:Alms1	APN	6	85641371	missense	possibly damaging	0.94
IGL00658:Alms1	APN	6	85628961	missense	probably damaging	1.00
IGL00835:Alms1	APN	6	85622134	missense	probably damaging	1.00
IGL00930:Alms1	APN	6	85601310	missense	probably damaging	0.98
IGL01446:Alms1	APN	6	85696701	missense	probably damaging	1.00
IGL01448:Alms1	APN	6	85677899	missense	possibly damaging	0.93
IGL01563:Alms1	APN	6	85627983	missense	probably damaging	1.00
IGL01632:Alms1	APN	6	85627946	missense	probably benign	0.07
IGL01651:Alms1	APN	6	85656476	missense	probably benign	0.05
IGL01670:Alms1	APN	6	85678150	missense	probably benign	0.00
IGL01716:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01719:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01720:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01723:Alms1	APN	6	85628094	missense	probably benign	0.01
IGL01877:Alms1	APN	6	85622411	missense	possibly damaging	0.55
IGL01919:Alms1	APN	6	85628004	missense	possibly damaging	0.77
IGL01976:Alms1	APN	6	85622665	missense	possibly damaging	0.73
IGL02003:Alms1	APN	6	85622223	missense	possibly damaging	0.54
IGL02069:Alms1	APN	6	85628823	missense	probably benign	0.12
IGL02070:Alms1	APN	6	85651403	missense	possibly damaging	0.74
IGL02079:Alms1	APN	6	85628634	missense	probably damaging	0.98
IGL02081:Alms1	APN	6	85620303	missense	possibly damaging	0.55
IGL02379:Alms1	APN	6	85629633	missense	probably damaging	0.98
IGL02412:Alms1	APN	6	85628872	missense	possibly damaging	0.91
IGL02606:Alms1	APN	6	85599967	missense	probably benign
IGL02636:Alms1	APN	6	85628654	missense	probably benign	0.28
IGL02702:Alms1	APN	6	85599849	missense	probably benign	0.12
IGL02815:Alms1	APN	6	85667957	critical splice donor site	probably null
IGL02926:Alms1	APN	6	85641450	missense	probably damaging	1.00
IGL02945:Alms1	APN	6	85620933	missense	probably damaging	0.96
IGL02959:Alms1	APN	6	85629052	nonsense	probably null
IGL03124:Alms1	APN	6	85678419	missense	probably benign	0.03
IGL03199:Alms1	APN	6	85622497	missense	possibly damaging	0.68
IGL03209:Alms1	APN	6	85599973	splice site	probably benign
IGL03247:Alms1	APN	6	85678597	missense	possibly damaging	0.85
ares	UTSW	6	85621275	nonsense	probably null
ares2	UTSW	6	85677990	nonsense	probably null
butterball	UTSW	6	85696771	missense	probably damaging	0.99
earthquake	UTSW	6	85628735	nonsense	probably null
fatty	UTSW	6	85627934	nonsense	probably null
gut_check	UTSW	6	85620369	nonsense	probably null
portly	UTSW	6	85619712	missense	probably benign	0.00
replete	UTSW	6	85629208	missense	possibly damaging	0.87
PIT4468001:Alms1	UTSW	6	85624719	critical splice donor site	probably null
R0003:Alms1	UTSW	6	85629210	missense	possibly damaging	0.90
R0095:Alms1	UTSW	6	85620253	missense	possibly damaging	0.90
R0110:Alms1	UTSW	6	85620369	nonsense	probably null
R0114:Alms1	UTSW	6	85619803	missense	probably benign	0.00
R0153:Alms1	UTSW	6	85641381	missense	possibly damaging	0.94
R0217:Alms1	UTSW	6	85622930	missense	probably damaging	0.99
R0328:Alms1	UTSW	6	85610814	splice site	probably null
R0410:Alms1	UTSW	6	85587803	missense	unknown
R0469:Alms1	UTSW	6	85620369	nonsense	probably null
R0491:Alms1	UTSW	6	85702600	missense	probably damaging	0.98
R0522:Alms1	UTSW	6	85621615	missense	probably benign
R0525:Alms1	UTSW	6	85587760	missense	unknown
R0611:Alms1	UTSW	6	85678671	missense	possibly damaging	0.61
R0637:Alms1	UTSW	6	85623033	missense	possibly damaging	0.85
R0718:Alms1	UTSW	6	85621821	missense	probably benign	0.00
R0831:Alms1	UTSW	6	85628520	missense	probably benign	0.00
R1318:Alms1	UTSW	6	85628549	missense	possibly damaging	0.62
R1340:Alms1	UTSW	6	85667957	critical splice donor site	probably null
R1561:Alms1	UTSW	6	85629052	nonsense	probably null
R1648:Alms1	UTSW	6	85678402	missense	probably damaging	0.99
R1697:Alms1	UTSW	6	85622454	missense	possibly damaging	0.94
R1699:Alms1	UTSW	6	85622880	missense	possibly damaging	0.46
R1715:Alms1	UTSW	6	85629052	nonsense	probably null
R1723:Alms1	UTSW	6	85628753	missense	probably damaging	1.00
R1734:Alms1	UTSW	6	85641550	critical splice donor site	probably null
R1758:Alms1	UTSW	6	85628505	missense	probably damaging	0.99
R1804:Alms1	UTSW	6	85621275	nonsense	probably null
R1835:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R1836:Alms1	UTSW	6	85678503	missense	possibly damaging	0.94
R2077:Alms1	UTSW	6	85622309	missense	possibly damaging	0.93
R2246:Alms1	UTSW	6	85622967	missense	possibly damaging	0.91
R2254:Alms1	UTSW	6	85619848	missense	probably damaging	1.00
R2280:Alms1	UTSW	6	85677973	missense	probably damaging	0.99
R2516:Alms1	UTSW	6	85667963	splice site	probably benign
R2519:Alms1	UTSW	6	85667963	splice site	probably benign
R2566:Alms1	UTSW	6	85622482	missense	possibly damaging	0.84
R2850:Alms1	UTSW	6	85621299	missense	probably benign	0.00
R2850:Alms1	UTSW	6	85667963	splice site	probably benign
R2932:Alms1	UTSW	6	85620562	missense	possibly damaging	0.89
R2944:Alms1	UTSW	6	85628391	missense	probably damaging	1.00
R2980:Alms1	UTSW	6	85628835	missense	probably damaging	1.00
R3084:Alms1	UTSW	6	85678140	missense	probably benign
R3086:Alms1	UTSW	6	85678140	missense	probably benign
R3122:Alms1	UTSW	6	85667963	splice site	probably benign
R3404:Alms1	UTSW	6	85667963	splice site	probably benign
R3405:Alms1	UTSW	6	85667963	splice site	probably benign
R3804:Alms1	UTSW	6	85619647	missense	probably damaging	1.00
R3904:Alms1	UTSW	6	85621678	missense	probably benign	0.00
R4014:Alms1	UTSW	6	85678352	missense	probably benign	0.41
R4056:Alms1	UTSW	6	85587803	missense	unknown
R4067:Alms1	UTSW	6	85621289	missense	probably damaging	1.00
R4110:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4111:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4112:Alms1	UTSW	6	85620888	missense	probably benign	0.00
R4194:Alms1	UTSW	6	85677990	nonsense	probably null
R4464:Alms1	UTSW	6	85620021	missense	possibly damaging	0.66
R4539:Alms1	UTSW	6	85620478	missense	possibly damaging	0.78
R4554:Alms1	UTSW	6	85624617	missense	probably benign
R4696:Alms1	UTSW	6	85620522	missense	probably damaging	1.00
R4825:Alms1	UTSW	6	85678245	missense	probably damaging	0.99
R4921:Alms1	UTSW	6	85628546	missense	probably benign	0.13
R5030:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R5051:Alms1	UTSW	6	85627934	nonsense	probably null
R5085:Alms1	UTSW	6	85620732	missense	possibly damaging	0.55
R5141:Alms1	UTSW	6	85621432	missense	probably benign	0.01
R5233:Alms1	UTSW	6	85656371	splice site	probably null
R5310:Alms1	UTSW	6	85615368	missense	possibly damaging	0.79
R5344:Alms1	UTSW	6	85696789	missense	probably benign	0.04
R5394:Alms1	UTSW	6	85623088	missense	probably benign	0.01
R5460:Alms1	UTSW	6	85696731	missense	probably benign	0.08
R5558:Alms1	UTSW	6	85641329	nonsense	probably null
R5650:Alms1	UTSW	6	85620271	missense	probably damaging	1.00
R5667:Alms1	UTSW	6	85696771	missense	probably damaging	0.99
R5671:Alms1	UTSW	6	85629208	missense	possibly damaging	0.87
R5688:Alms1	UTSW	6	85599895	missense	possibly damaging	0.92
R5815:Alms1	UTSW	6	85622838	missense	probably damaging	0.99
R5892:Alms1	UTSW	6	85620903	missense	probably damaging	0.99
R5947:Alms1	UTSW	6	85619712	missense	probably benign	0.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6031:Alms1	UTSW	6	85622955	missense	probably damaging	1.00
R6144:Alms1	UTSW	6	85623074	missense	probably damaging	0.98
R6258:Alms1	UTSW	6	85628735	nonsense	probably null
R6260:Alms1	UTSW	6	85628735	nonsense	probably null
R6455:Alms1	UTSW	6	85696657	missense	probably damaging	0.99
R6569:Alms1	UTSW	6	85641339	missense	probably benign	0.07
R6637:Alms1	UTSW	6	85619734	missense	possibly damaging	0.78
R6866:Alms1	UTSW	6	85621098	missense	possibly damaging	0.85
R6918:Alms1	UTSW	6	85622661	missense	possibly damaging	0.87
R7121:Alms1	UTSW	6	85624622	missense	probably damaging	1.00
R7179:Alms1	UTSW	6	85621369	missense	probably benign	0.09
R7334:Alms1	UTSW	6	85641450	missense	probably damaging	0.99
R7376:Alms1	UTSW	6	85622106	missense	probably benign	0.10
R7394:Alms1	UTSW	6	85622223	missense	possibly damaging	0.54
R7413:Alms1	UTSW	6	85628306	missense	probably benign	0.03
R7511:Alms1	UTSW	6	85609425	missense	unknown
R7542:Alms1	UTSW	6	85629362	missense	possibly damaging	0.62
R7562:Alms1	UTSW	6	85620412	missense	probably damaging	1.00
R7575:Alms1	UTSW	6	85622159	missense	possibly damaging	0.49
R7577:Alms1	UTSW	6	85615320	missense	probably benign	0.09
R7618:Alms1	UTSW	6	85678417	missense	probably benign	0.07
R7653:Alms1	UTSW	6	85620595	missense	possibly damaging	0.47
R7672:Alms1	UTSW	6	85615351	missense	probably damaging	1.00
R7807:Alms1	UTSW	6	85622976	missense	possibly damaging	0.91
R7815:Alms1	UTSW	6	85615358	missense	probably benign	0.42
R7849:Alms1	UTSW	6	85621497	missense	possibly damaging	0.48
R7944:Alms1	UTSW	6	85641380	missense	probably benign	0.03
R7954:Alms1	UTSW	6	85621162	missense	probably damaging	0.98
R7971:Alms1	UTSW	6	85628679	missense	probably benign
R8048:Alms1	UTSW	6	85641334	missense	probably benign	0.13
R8223:Alms1	UTSW	6	85643240	nonsense	probably null
R8332:Alms1	UTSW	6	85620579	missense	probably benign	0.05
R8374:Alms1	UTSW	6	85608991	missense	probably benign	0.41
R8470:Alms1	UTSW	6	85641375	missense	probably damaging	0.99
R8755:Alms1	UTSW	6	85621574	missense	probably benign	0.01
R8979:Alms1	UTSW	6	85621027	missense	probably damaging	0.98
R9044:Alms1	UTSW	6	85696753	missense	probably damaging	0.98
R9057:Alms1	UTSW	6	85609832	missense	unknown
R9224:Alms1	UTSW	6	85621788	missense	possibly damaging	0.69
R9259:Alms1	UTSW	6	85667891	missense	possibly damaging	0.94
R9401:Alms1	UTSW	6	85678019	nonsense	probably null
R9459:Alms1	UTSW	6	85627964	missense	probably damaging	0.98
R9633:Alms1	UTSW	6	85623143	missense	probably damaging	0.99
R9716:Alms1	UTSW	6	85601252	missense	possibly damaging	0.84
R9730:Alms1	UTSW	6	85629438	missense	probably benign	0.00
R9790:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9791:Alms1	UTSW	6	85619443	missense	probably benign	0.04
R9802:Alms1	UTSW	6	85629238	missense	possibly damaging	0.61
X0013:Alms1	UTSW	6	85656455	missense	probably damaging	1.00
X0025:Alms1	UTSW	6	85620210	missense	probably damaging	0.96
Z1176:Alms1	UTSW	6	85678418	missense	probably benign	0.41

Predicted Primers

PCR Primer
(F):5'- TTTTCTATCAGCAGGGGTTGCCAG -3'
(R):5'- TGCAGATCCTCTTCAGACAGACCAC -3'

Sequencing Primer
(F):5'- TTGCCAGATAGGCATTCAGC -3'
(R):5'- CACCATCTGGCAGGGTTTG -3'

Posted On

2013-06-12