Incidental Mutation 'R5305:Sema3b'
ID478016
Institutional Source Beutler Lab
Gene Symbol Sema3b
Ensembl Gene ENSMUSG00000057969
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B
SynonymsSemA, sema5, semaV, Semaa, LUCA-1, SemA
MMRRC Submission 042888-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5305 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107597674-107609229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107603337 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 137 (H137R)
Ref Sequence ENSEMBL: ENSMUSP00000141614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073448] [ENSMUST00000102529] [ENSMUST00000102530] [ENSMUST00000102531] [ENSMUST00000102532] [ENSMUST00000123926] [ENSMUST00000193180] [ENSMUST00000194433] [ENSMUST00000194606] [ENSMUST00000195057] [ENSMUST00000195662] [ENSMUST00000195662]
Predicted Effect probably damaging
Transcript: ENSMUST00000073448
AA Change: H137R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073152
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102529
AA Change: H137R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099588
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102530
AA Change: H137R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099589
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102531
AA Change: H137R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099590
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102532
AA Change: H137R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099591
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
PSI 515 567 1.77e-13 SMART
IG 577 660 7.7e-5 SMART
low complexity region 665 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123926
AA Change: H137R

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137952
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 55 497 6.37e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193180
AA Change: H137R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141726
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 148 8.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193551
Predicted Effect probably damaging
Transcript: ENSMUST00000194433
AA Change: H137R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141403
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 172 3.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194606
Predicted Effect probably benign
Transcript: ENSMUST00000195057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195472
Predicted Effect probably null
Transcript: ENSMUST00000195662
AA Change: H137R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195662
AA Change: H137R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141614
Gene: ENSMUSG00000057969
AA Change: H137R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 55 137 8.4e-26 PFAM
Meta Mutation Damage Score 0.7849 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a secreted protein that belongs to the class 3 semaphorin/collapsin family. Members of this family play a role in growth cone guidance during neurogenesis. The encoded protein inhibits axonal extension. This protein is thought to be an osteoblast protein that regulates bone mass and affects skeletal homeostasis. A similar gene in humans functions as a tumor suppressor gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for one knock-out allele are viable and fertile with no obvious pathological abnormalities. Mice homozygous for a second knock-out allele exhibit improper positioning of a major brain commissural projection, the anterior commissure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik G A 15: 82,059,219 V11M possibly damaging Het
Acot8 A G 2: 164,795,765 V179A probably benign Het
Actb A G 5: 142,904,230 I194T probably benign Het
Ap1g2 A G 14: 55,099,076 V787A probably benign Het
Areg G T 5: 91,144,449 A203S probably damaging Het
Asb13 A T 13: 3,643,479 D79V probably damaging Het
Atad2b C T 12: 4,965,855 T527I probably damaging Het
Auts2 T G 5: 131,443,794 probably benign Het
Ceacam3 T A 7: 17,151,576 S35T probably damaging Het
Crebzf T C 7: 90,444,134 probably benign Het
Cttnbp2 G T 6: 18,381,098 N1366K probably benign Het
Cubn C A 2: 13,388,939 C1417F probably damaging Het
Dot1l C T 10: 80,790,793 P162S probably benign Het
Epc1 G A 18: 6,490,690 probably benign Het
Eps8l1 A G 7: 4,477,896 S613G possibly damaging Het
Erich6 T G 3: 58,625,116 I357L probably benign Het
Foxj3 T A 4: 119,619,958 S288T possibly damaging Het
Gls2 T G 10: 128,204,709 Y326* probably null Het
Gm11595 G A 11: 99,772,555 R100C unknown Het
Gm7535 T C 17: 17,911,799 probably benign Het
Gxylt2 T G 6: 100,787,218 L288R probably damaging Het
Kdm4a T C 4: 118,160,501 Y456C probably damaging Het
Mgat4c T A 10: 102,389,279 F451L possibly damaging Het
Mrpl20 G A 4: 155,803,705 R17H probably damaging Het
Mtf2 A G 5: 108,104,499 T465A possibly damaging Het
Mycbp2 A C 14: 103,346,321 L66R probably benign Het
Nos1ap T A 1: 170,349,399 K145M probably damaging Het
Nr2e1 A T 10: 42,571,487 Y176* probably null Het
Obscn T C 11: 59,012,715 T7628A possibly damaging Het
Olfr1353 A T 10: 78,970,556 K302N possibly damaging Het
Pitx2 T G 3: 129,215,840 V129G probably damaging Het
Polr2e A G 10: 80,038,063 probably benign Het
Ppard A G 17: 28,298,858 D300G probably damaging Het
Ppp1r27 A G 11: 120,550,917 V46A probably benign Het
Prex2 T A 1: 11,107,678 V332E probably damaging Het
Prss30 T G 17: 23,972,776 Y257S probably benign Het
Ptprd T C 4: 75,982,626 E1082G probably damaging Het
Rab3c T A 13: 110,181,077 R89S probably damaging Het
Rimbp2 A G 5: 128,797,381 V389A possibly damaging Het
Rims1 T A 1: 22,596,542 R119S probably damaging Het
Sf3b4 G C 3: 96,173,642 A89P probably damaging Het
Sgta T A 10: 81,046,247 Q298L probably damaging Het
Spag9 C A 11: 94,069,012 D342E probably damaging Het
Sry T A Y: 2,662,982 D226V unknown Het
Sv2a A G 3: 96,185,458 E158G possibly damaging Het
Sytl2 A G 7: 90,381,863 probably benign Het
Thbs3 T A 3: 89,217,976 probably benign Het
Top3a A T 11: 60,762,539 N56K possibly damaging Het
Ttc37 G A 13: 76,147,767 E1050K possibly damaging Het
Tyk2 T C 9: 21,109,381 D918G probably damaging Het
Uqcrh A G 4: 116,067,284 probably benign Het
Vmn1r61 A G 7: 5,610,815 S167P probably damaging Het
Wdr25 C A 12: 109,026,440 H74N probably damaging Het
Zfp458 T C 13: 67,256,318 N686D probably benign Het
Zfp574 T A 7: 25,081,090 H512Q probably damaging Het
Zfp976 A T 7: 42,613,478 Y312N probably benign Het
Zscan4c G A 7: 11,009,535 V354I probably benign Het
Other mutations in Sema3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Sema3b APN 9 107604041 critical splice donor site probably null
IGL02750:Sema3b APN 9 107603164 missense probably benign 0.02
IGL02878:Sema3b APN 9 107600993 missense probably damaging 0.97
IGL03004:Sema3b APN 9 107602915 missense possibly damaging 0.72
IGL03026:Sema3b APN 9 107602063 missense probably damaging 1.00
IGL03129:Sema3b APN 9 107599796 unclassified probably benign
IGL03334:Sema3b APN 9 107604077 missense probably damaging 1.00
R0373:Sema3b UTSW 9 107602918 missense probably benign 0.05
R0384:Sema3b UTSW 9 107600966 missense probably damaging 1.00
R0883:Sema3b UTSW 9 107604156 missense possibly damaging 0.77
R3916:Sema3b UTSW 9 107600458 missense probably damaging 1.00
R3971:Sema3b UTSW 9 107600368 missense probably benign
R4212:Sema3b UTSW 9 107603398 missense probably damaging 1.00
R4647:Sema3b UTSW 9 107599051 missense possibly damaging 0.79
R4694:Sema3b UTSW 9 107605002 missense probably benign 0.03
R4791:Sema3b UTSW 9 107603813 missense probably damaging 1.00
R4853:Sema3b UTSW 9 107602067 unclassified probably null
R5487:Sema3b UTSW 9 107600962 missense probably damaging 1.00
R5745:Sema3b UTSW 9 107601429 missense probably damaging 0.98
R5751:Sema3b UTSW 9 107599714 missense probably benign
R6086:Sema3b UTSW 9 107600848 missense probably damaging 1.00
R6306:Sema3b UTSW 9 107600920 missense possibly damaging 0.88
R6594:Sema3b UTSW 9 107598826 missense probably benign 0.01
R6816:Sema3b UTSW 9 107600350 missense probably benign 0.08
R6833:Sema3b UTSW 9 107603316 missense probably benign 0.04
R7320:Sema3b UTSW 9 107600942 missense probably benign
R7448:Sema3b UTSW 9 107602963 missense probably damaging 1.00
R7687:Sema3b UTSW 9 107603814 missense probably damaging 1.00
Z1088:Sema3b UTSW 9 107599034 unclassified probably null
Z1176:Sema3b UTSW 9 107599639 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CGATGCCTTGGGTCATAAGGAG -3'
(R):5'- ATGTTAGTACTTCCCTGGGCTG -3'

Sequencing Primer
(F):5'- TGGGTCATAAGGAGTCTTCCCC -3'
(R):5'- TACTTCCCTGGGCTGATGCAG -3'
Posted On2017-05-16