Incidental Mutation 'LCD18:C530008M17Rik'
ID478032
Institutional Source Beutler Lab
Gene Symbol C530008M17Rik
Ensembl Gene ENSMUSG00000036377
Gene NameRIKEN cDNA C530008M17 gene
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #LCD18 (G1)
Quality Score133
Status Validated
Chromosome5
Chromosomal Location76656512-76873554 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG to GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG at 76658742 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086909] [ENSMUST00000128112]
Predicted Effect probably benign
Transcript: ENSMUST00000086909
SMART Domains Protein: ENSMUSP00000084125
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125922
Predicted Effect probably benign
Transcript: ENSMUST00000128112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194526
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in C530008M17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:C530008M17Rik APN 5 76866056 unclassified probably benign
IGL00660:C530008M17Rik APN 5 76854933 critical splice acceptor site probably null
IGL00924:C530008M17Rik APN 5 76858986 missense unknown
IGL01025:C530008M17Rik APN 5 76658074 intron probably benign
IGL01122:C530008M17Rik APN 5 76870675 makesense probably null
IGL01393:C530008M17Rik APN 5 76858971 missense unknown
IGL01526:C530008M17Rik APN 5 76857631 missense unknown
IGL01986:C530008M17Rik APN 5 76858610 missense unknown
IGL02009:C530008M17Rik APN 5 76848970 missense possibly damaging 0.61
IGL02724:C530008M17Rik APN 5 76858459 missense unknown
IGL02869:C530008M17Rik APN 5 76859043 missense unknown
IGL03030:C530008M17Rik APN 5 76857616 missense unknown
IGL03150:C530008M17Rik APN 5 76867250 missense probably damaging 0.99
R0975:C530008M17Rik UTSW 5 76856318 splice site probably benign
R1329:C530008M17Rik UTSW 5 76657932 intron probably benign
R1439:C530008M17Rik UTSW 5 76840910 missense probably damaging 0.99
R1750:C530008M17Rik UTSW 5 76857675 missense unknown
R1773:C530008M17Rik UTSW 5 76867205 missense possibly damaging 0.54
R1885:C530008M17Rik UTSW 5 76856742 missense unknown
R1924:C530008M17Rik UTSW 5 76858623 missense unknown
R2483:C530008M17Rik UTSW 5 76856409 missense probably damaging 0.98
R3840:C530008M17Rik UTSW 5 76859011 missense unknown
R3841:C530008M17Rik UTSW 5 76859011 missense unknown
R3874:C530008M17Rik UTSW 5 76840892 missense probably damaging 1.00
R3883:C530008M17Rik UTSW 5 76856574 missense unknown
R4033:C530008M17Rik UTSW 5 76858465 missense unknown
R4401:C530008M17Rik UTSW 5 76848916 missense probably damaging 0.98
R4749:C530008M17Rik UTSW 5 76858834 missense unknown
R4884:C530008M17Rik UTSW 5 76848835 missense probably damaging 1.00
R4980:C530008M17Rik UTSW 5 76857574 missense unknown
R5010:C530008M17Rik UTSW 5 76657834 utr 5 prime probably benign
R5086:C530008M17Rik UTSW 5 76857124 missense unknown
R5468:C530008M17Rik UTSW 5 76840763 intron probably benign
R5786:C530008M17Rik UTSW 5 76866196 splice site probably null
R5813:C530008M17Rik UTSW 5 76858428 missense unknown
R5866:C530008M17Rik UTSW 5 76857537 missense unknown
R5928:C530008M17Rik UTSW 5 76841734 intron probably benign
R6273:C530008M17Rik UTSW 5 76857721 missense unknown
R6577:C530008M17Rik UTSW 5 76866100 unclassified probably benign
R6838:C530008M17Rik UTSW 5 76858209 missense unknown
R6849:C530008M17Rik UTSW 5 76857010 missense unknown
R6849:C530008M17Rik UTSW 5 76857157 missense unknown
R6914:C530008M17Rik UTSW 5 76857007 missense unknown
R7017:C530008M17Rik UTSW 5 76856948 small deletion probably benign
R7094:C530008M17Rik UTSW 5 76859032 missense unknown
R7367:C530008M17Rik UTSW 5 76856602 missense unknown
R7394:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7436:C530008M17Rik UTSW 5 76856954 small deletion probably benign
R7443:C530008M17Rik UTSW 5 76856638 missense unknown
R7500:C530008M17Rik UTSW 5 76658058 missense unknown
R7566:C530008M17Rik UTSW 5 76866275 intron probably null
R7633:C530008M17Rik UTSW 5 76857520 missense unknown
R7728:C530008M17Rik UTSW 5 76857469 missense unknown
Z1176:C530008M17Rik UTSW 5 76857246 missense unknown
Predicted Primers PCR Primer
(F):5'- CAATGGCTTTCCGAATTGTGG -3'
(R):5'- ATGCCAAATGACCGCTAGCC -3'

Sequencing Primer
(F):5'- CAATGGCTTTCCGAATTGTGGATTTC -3'
(R):5'- CAACTACTGGAGGTAATTTTTACGGG -3'
Posted On2017-05-17