Incidental Mutation 'R0510:Trpm1'
ID 47805
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Name transient receptor potential cation channel, subfamily M, member 1
Synonyms Mlsn1, melastatin, 4732499L03Rik, LTRPC1
MMRRC Submission 038704-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0510 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 63803583-63919523 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 63873506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 587 (G587D)
Ref Sequence ENSEMBL: ENSMUSP00000146226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205994] [ENSMUST00000206277] [ENSMUST00000206263] [ENSMUST00000206314]
AlphaFold Q2TV84
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: G587D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: G587D

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107525
AA Change: G587D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: G587D

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176623
AA Change: G95D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134805
Gene: ENSMUSG00000030523
AA Change: G95D

DomainStartEndE-ValueType
Blast:ANK 13 41 1e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177102
AA Change: G471D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: G471D

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
low complexity region 173 191 N/A INTRINSIC
low complexity region 340 375 N/A INTRINSIC
Blast:ANK 389 417 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000205348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205939
Predicted Effect probably damaging
Transcript: ENSMUST00000205994
AA Change: G95D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: G587D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: G471D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 99% (102/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 A G 5: 105,125,482 (GRCm39) I67T probably damaging Het
Acoxl G A 2: 127,722,423 (GRCm39) probably null Het
Adam10 T A 9: 70,655,530 (GRCm39) W333R probably damaging Het
Ahnak C T 19: 8,995,596 (GRCm39) R5627* probably null Het
Alms1 A T 6: 85,597,351 (GRCm39) R1195* probably null Het
Ap2m1 T A 16: 20,360,990 (GRCm39) I334N possibly damaging Het
Brd8dc A T 18: 34,729,204 (GRCm39) D42E probably damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc110 T A 8: 46,388,194 (GRCm39) N50K probably benign Het
Ccdc168 T A 1: 44,100,257 (GRCm39) K280N possibly damaging Het
Cdhr1 T C 14: 36,802,633 (GRCm39) Y610C probably damaging Het
Cdkal1 C A 13: 29,875,579 (GRCm39) probably null Het
Celsr3 G A 9: 108,704,204 (GRCm39) C229Y possibly damaging Het
Clca4b A T 3: 144,619,112 (GRCm39) Y676N probably damaging Het
Col11a1 A T 3: 113,899,105 (GRCm39) probably benign Het
Cpe T A 8: 65,064,501 (GRCm39) I233F probably damaging Het
Cpsf1 A T 15: 76,487,857 (GRCm39) probably benign Het
Cpsf2 T C 12: 101,955,045 (GRCm39) V272A probably damaging Het
Creld2 A T 15: 88,704,159 (GRCm39) N50I probably damaging Het
Cyb5r1 T C 1: 134,337,430 (GRCm39) probably benign Het
Dcaf11 T C 14: 55,806,537 (GRCm39) V446A probably damaging Het
Defa34 A G 8: 22,155,988 (GRCm39) probably null Het
Dgat1 T C 15: 76,395,767 (GRCm39) Y72C possibly damaging Het
Efr3b G T 12: 4,032,058 (GRCm39) D183E probably benign Het
Enpp3 A T 10: 24,652,679 (GRCm39) D759E probably damaging Het
Epyc A G 10: 97,485,625 (GRCm39) T22A probably benign Het
Etfbkmt C T 6: 149,052,082 (GRCm39) R96W probably benign Het
Fam83b G T 9: 76,400,108 (GRCm39) L332I possibly damaging Het
Fat3 C A 9: 15,910,981 (GRCm39) E1674* probably null Het
Fbn1 A G 2: 125,184,845 (GRCm39) probably benign Het
Gm5134 C A 10: 75,810,079 (GRCm39) T120N probably benign Het
Gmip C T 8: 70,268,259 (GRCm39) probably benign Het
Gpbp1 G T 13: 111,577,279 (GRCm39) Q204K possibly damaging Het
Gpr108 T C 17: 57,542,358 (GRCm39) D549G possibly damaging Het
Gsdme C A 6: 50,223,107 (GRCm39) probably benign Het
Gucy2e T C 11: 69,126,402 (GRCm39) D326G probably benign Het
H2-Eb2 C T 17: 34,553,218 (GRCm39) Q135* probably null Het
Hectd4 T A 5: 121,419,959 (GRCm39) Y635N possibly damaging Het
Hectd4 G A 5: 121,443,736 (GRCm39) E1319K possibly damaging Het
Hs3st2 T C 7: 121,099,792 (GRCm39) S213P probably damaging Het
Ikbkb A T 8: 23,161,651 (GRCm39) C412* probably null Het
Itpr2 T C 6: 146,319,477 (GRCm39) T188A possibly damaging Het
Kcnh1 T A 1: 192,101,249 (GRCm39) probably benign Het
Kctd21 T C 7: 96,996,748 (GRCm39) F74L probably damaging Het
Krt23 T A 11: 99,377,608 (GRCm39) I133L probably damaging Het
Krt74 T C 15: 101,671,751 (GRCm39) noncoding transcript Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lmtk3 T A 7: 45,443,536 (GRCm39) L740M possibly damaging Het
Lrrc10 T A 10: 116,881,695 (GRCm39) L123Q probably damaging Het
Map1a A T 2: 121,136,255 (GRCm39) H2357L probably benign Het
Mbl1 A G 14: 40,880,706 (GRCm39) N198S probably damaging Het
Mcf2l A G 8: 13,047,337 (GRCm39) D233G probably damaging Het
Msto1 A G 3: 88,818,848 (GRCm39) L269P probably benign Het
Mtss1 A T 15: 58,828,387 (GRCm39) D175E probably benign Het
Myef2 A T 2: 124,950,954 (GRCm39) probably benign Het
Neb A T 2: 52,180,755 (GRCm39) probably benign Het
Or14a259 T C 7: 86,013,035 (GRCm39) N170S probably benign Het
Or4a39 A T 2: 89,237,135 (GRCm39) M96K probably damaging Het
Or5w15 A G 2: 87,567,825 (GRCm39) V281A probably damaging Het
Parp2 T A 14: 51,057,130 (GRCm39) Y361N probably damaging Het
Parp3 A G 9: 106,348,995 (GRCm39) F466L possibly damaging Het
Pcdh15 A T 10: 74,126,808 (GRCm39) N296Y probably damaging Het
Pdzrn3 A T 6: 101,128,014 (GRCm39) I884N probably damaging Het
Pim1 T C 17: 29,712,883 (GRCm39) probably benign Het
Pou6f2 A G 13: 18,314,308 (GRCm39) probably benign Het
Prelid3b A G 2: 174,307,743 (GRCm39) probably benign Het
Proc G A 18: 32,258,171 (GRCm39) T258I probably benign Het
Rab3gap2 T C 1: 184,992,705 (GRCm39) probably benign Het
Rb1cc1 A C 1: 6,319,395 (GRCm39) K938T probably benign Het
Rem2 T C 14: 54,713,754 (GRCm39) probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rin2 A G 2: 145,702,953 (GRCm39) K550E probably benign Het
Rps6ka4 G T 19: 6,817,866 (GRCm39) T17N probably benign Het
Rtn4 T A 11: 29,683,849 (GRCm39) probably benign Het
Ruvbl2 C T 7: 45,080,730 (GRCm39) probably benign Het
Scaper A G 9: 55,665,346 (GRCm39) probably benign Het
Sdc2 T C 15: 33,017,235 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,584,956 (GRCm39) N318I possibly damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Slco2b1 T A 7: 99,310,743 (GRCm39) M603L probably benign Het
Smpdl3b A G 4: 132,472,449 (GRCm39) V108A probably damaging Het
Sptbn4 C T 7: 27,060,991 (GRCm39) probably null Het
Srrm1 G A 4: 135,065,854 (GRCm39) probably benign Het
Ssh1 A T 5: 114,084,766 (GRCm39) D448E probably benign Het
Ssmem1 A T 6: 30,519,547 (GRCm39) probably null Het
Sv2b T G 7: 74,786,140 (GRCm39) M427L probably benign Het
Syne1 A G 10: 5,317,600 (GRCm39) L498P probably damaging Het
Syne2 T C 12: 75,900,923 (GRCm39) probably null Het
Taf6l G T 19: 8,755,885 (GRCm39) H254Q probably benign Het
Traf3ip3 T A 1: 192,860,539 (GRCm39) probably null Het
Ttn A G 2: 76,560,756 (GRCm39) V29215A probably damaging Het
Ubr4 T G 4: 139,157,534 (GRCm39) S2364A probably benign Het
Ush2a T A 1: 188,466,860 (GRCm39) probably benign Het
Vmn2r100 C A 17: 19,742,382 (GRCm39) P252Q possibly damaging Het
Vmn2r57 A T 7: 41,077,216 (GRCm39) S317T possibly damaging Het
Vwa2 A G 19: 56,886,500 (GRCm39) probably benign Het
Wdr73 G A 7: 80,547,698 (GRCm39) Q107* probably null Het
Zbtb10 T A 3: 9,329,728 (GRCm39) V362E probably damaging Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp296 A T 7: 19,311,831 (GRCm39) M113L probably benign Het
Zfp729b A T 13: 67,739,253 (GRCm39) V1004E probably benign Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 63,893,198 (GRCm39) missense probably damaging 1.00
IGL00465:Trpm1 APN 7 63,897,215 (GRCm39) missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 63,885,572 (GRCm39) missense probably benign 0.24
IGL01148:Trpm1 APN 7 63,893,312 (GRCm39) missense probably damaging 1.00
IGL01303:Trpm1 APN 7 63,860,578 (GRCm39) critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 63,884,767 (GRCm39) missense probably benign 0.18
IGL01433:Trpm1 APN 7 63,854,276 (GRCm39) missense probably damaging 1.00
IGL01506:Trpm1 APN 7 63,893,329 (GRCm39) missense probably damaging 1.00
IGL01626:Trpm1 APN 7 63,918,637 (GRCm39) missense probably damaging 1.00
IGL01640:Trpm1 APN 7 63,876,645 (GRCm39) missense probably damaging 1.00
IGL01899:Trpm1 APN 7 63,884,742 (GRCm39) missense probably benign 0.24
IGL01959:Trpm1 APN 7 63,858,723 (GRCm39) missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 63,860,613 (GRCm39) missense probably damaging 1.00
IGL02268:Trpm1 APN 7 63,867,362 (GRCm39) missense probably damaging 0.96
IGL02331:Trpm1 APN 7 63,884,800 (GRCm39) missense probably benign 0.30
IGL02334:Trpm1 APN 7 63,895,690 (GRCm39) critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 63,868,869 (GRCm39) missense probably damaging 1.00
IGL02425:Trpm1 APN 7 63,890,175 (GRCm39) missense probably damaging 0.96
IGL02485:Trpm1 APN 7 63,918,862 (GRCm39) missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 63,848,972 (GRCm39) missense probably benign 0.00
IGL02640:Trpm1 APN 7 63,868,881 (GRCm39) missense probably damaging 0.97
IGL02827:Trpm1 APN 7 63,868,908 (GRCm39) missense probably null 1.00
PIT4458001:Trpm1 UTSW 7 63,918,309 (GRCm39) missense possibly damaging 0.94
PIT4544001:Trpm1 UTSW 7 63,848,998 (GRCm39) intron probably benign
R0012:Trpm1 UTSW 7 63,918,339 (GRCm39) missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 63,897,970 (GRCm39) missense probably damaging 1.00
R0056:Trpm1 UTSW 7 63,893,334 (GRCm39) missense probably damaging 1.00
R0445:Trpm1 UTSW 7 63,894,590 (GRCm39) unclassified probably benign
R0463:Trpm1 UTSW 7 63,870,002 (GRCm39) missense probably benign 0.05
R0469:Trpm1 UTSW 7 63,873,506 (GRCm39) missense probably damaging 1.00
R1301:Trpm1 UTSW 7 63,852,801 (GRCm39) splice site probably null
R1397:Trpm1 UTSW 7 63,867,406 (GRCm39) missense probably damaging 1.00
R1588:Trpm1 UTSW 7 63,873,565 (GRCm39) missense possibly damaging 0.93
R1618:Trpm1 UTSW 7 63,890,283 (GRCm39) missense probably damaging 1.00
R1724:Trpm1 UTSW 7 63,885,569 (GRCm39) nonsense probably null
R1827:Trpm1 UTSW 7 63,884,755 (GRCm39) missense probably damaging 1.00
R1829:Trpm1 UTSW 7 63,876,530 (GRCm39) missense probably damaging 1.00
R1835:Trpm1 UTSW 7 63,880,016 (GRCm39) missense probably damaging 1.00
R1864:Trpm1 UTSW 7 63,917,764 (GRCm39) missense probably damaging 1.00
R1895:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1946:Trpm1 UTSW 7 63,873,556 (GRCm39) missense probably damaging 1.00
R1959:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1960:Trpm1 UTSW 7 63,879,978 (GRCm39) missense probably damaging 1.00
R1980:Trpm1 UTSW 7 63,858,182 (GRCm39) missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 63,858,780 (GRCm39) intron probably null
R2054:Trpm1 UTSW 7 63,890,303 (GRCm39) missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 63,884,736 (GRCm39) missense probably damaging 1.00
R2251:Trpm1 UTSW 7 63,859,724 (GRCm39) missense probably damaging 1.00
R3051:Trpm1 UTSW 7 63,918,849 (GRCm39) missense probably damaging 1.00
R3148:Trpm1 UTSW 7 63,884,760 (GRCm39) missense probably benign 0.00
R3195:Trpm1 UTSW 7 63,849,061 (GRCm39) nonsense probably null
R3615:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3616:Trpm1 UTSW 7 63,893,318 (GRCm39) missense probably damaging 1.00
R3623:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3624:Trpm1 UTSW 7 63,894,601 (GRCm39) missense probably damaging 1.00
R3721:Trpm1 UTSW 7 63,867,475 (GRCm39) intron probably benign
R3822:Trpm1 UTSW 7 63,867,451 (GRCm39) intron probably benign
R4441:Trpm1 UTSW 7 63,851,666 (GRCm39) missense probably damaging 1.00
R4490:Trpm1 UTSW 7 63,858,660 (GRCm39) nonsense probably null
R4666:Trpm1 UTSW 7 63,852,782 (GRCm39) missense probably damaging 1.00
R4701:Trpm1 UTSW 7 63,893,248 (GRCm39) missense probably damaging 1.00
R4781:Trpm1 UTSW 7 63,884,800 (GRCm39) missense probably benign 0.30
R4811:Trpm1 UTSW 7 63,858,054 (GRCm39) missense probably damaging 1.00
R5017:Trpm1 UTSW 7 63,894,580 (GRCm39) unclassified probably benign
R5030:Trpm1 UTSW 7 63,885,579 (GRCm39) missense probably damaging 1.00
R5195:Trpm1 UTSW 7 63,887,441 (GRCm39) missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 63,918,702 (GRCm39) missense probably damaging 1.00
R5304:Trpm1 UTSW 7 63,858,694 (GRCm39) missense probably benign 0.00
R5575:Trpm1 UTSW 7 63,870,018 (GRCm39) missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 63,858,159 (GRCm39) missense probably damaging 1.00
R5855:Trpm1 UTSW 7 63,918,710 (GRCm39) nonsense probably null
R5947:Trpm1 UTSW 7 63,873,547 (GRCm39) missense probably benign 0.07
R5988:Trpm1 UTSW 7 63,876,553 (GRCm39) missense probably benign 0.16
R6054:Trpm1 UTSW 7 63,918,450 (GRCm39) missense probably benign 0.00
R6088:Trpm1 UTSW 7 63,917,724 (GRCm39) missense probably damaging 0.98
R6259:Trpm1 UTSW 7 63,918,226 (GRCm39) missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 63,848,942 (GRCm39) missense probably benign 0.00
R6380:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.24
R6429:Trpm1 UTSW 7 63,918,252 (GRCm39) missense probably benign 0.00
R6600:Trpm1 UTSW 7 63,803,781 (GRCm39) start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 63,890,343 (GRCm39) missense probably damaging 0.96
R6939:Trpm1 UTSW 7 63,918,045 (GRCm39) missense probably benign 0.03
R6944:Trpm1 UTSW 7 63,893,181 (GRCm39) missense probably damaging 1.00
R7025:Trpm1 UTSW 7 63,876,462 (GRCm39) critical splice acceptor site probably null
R7112:Trpm1 UTSW 7 63,885,593 (GRCm39) missense probably damaging 0.97
R7168:Trpm1 UTSW 7 63,918,445 (GRCm39) missense probably benign 0.01
R7219:Trpm1 UTSW 7 63,854,333 (GRCm39) missense possibly damaging 0.68
R7224:Trpm1 UTSW 7 63,868,854 (GRCm39) critical splice acceptor site probably null
R7285:Trpm1 UTSW 7 63,859,729 (GRCm39) nonsense probably null
R7367:Trpm1 UTSW 7 63,918,549 (GRCm39) missense probably benign 0.06
R7449:Trpm1 UTSW 7 63,858,723 (GRCm39) missense probably benign 0.14
R7466:Trpm1 UTSW 7 63,890,330 (GRCm39) missense probably damaging 0.99
R7498:Trpm1 UTSW 7 63,858,657 (GRCm39) missense possibly damaging 0.93
R7581:Trpm1 UTSW 7 63,854,303 (GRCm39) missense probably benign 0.00
R7776:Trpm1 UTSW 7 63,897,939 (GRCm39) missense probably benign 0.04
R8062:Trpm1 UTSW 7 63,851,689 (GRCm39) missense probably benign 0.18
R8069:Trpm1 UTSW 7 63,858,718 (GRCm39) missense possibly damaging 0.55
R8157:Trpm1 UTSW 7 63,849,017 (GRCm39) missense probably damaging 1.00
R8219:Trpm1 UTSW 7 63,851,699 (GRCm39) missense probably benign 0.35
R8258:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8259:Trpm1 UTSW 7 63,918,777 (GRCm39) missense probably benign 0.10
R8320:Trpm1 UTSW 7 63,918,541 (GRCm39) missense possibly damaging 0.56
R8536:Trpm1 UTSW 7 63,897,155 (GRCm39) missense probably damaging 1.00
R8544:Trpm1 UTSW 7 63,874,356 (GRCm39) splice site probably null
R8813:Trpm1 UTSW 7 63,851,756 (GRCm39) missense possibly damaging 0.68
R8912:Trpm1 UTSW 7 63,918,628 (GRCm39) missense probably benign 0.06
R8954:Trpm1 UTSW 7 63,858,089 (GRCm39) missense probably damaging 0.98
R9139:Trpm1 UTSW 7 63,848,943 (GRCm39) missense probably benign 0.00
R9205:Trpm1 UTSW 7 63,890,319 (GRCm39) missense possibly damaging 0.66
R9258:Trpm1 UTSW 7 63,884,713 (GRCm39) missense probably benign 0.01
R9283:Trpm1 UTSW 7 63,873,623 (GRCm39) missense probably benign 0.18
R9394:Trpm1 UTSW 7 63,918,480 (GRCm39) missense probably benign 0.00
R9430:Trpm1 UTSW 7 63,873,446 (GRCm39) missense probably benign 0.38
R9537:Trpm1 UTSW 7 63,803,616 (GRCm39) unclassified probably benign
R9616:Trpm1 UTSW 7 63,858,132 (GRCm39) missense probably damaging 0.99
R9774:Trpm1 UTSW 7 63,898,041 (GRCm39) missense possibly damaging 0.90
X0026:Trpm1 UTSW 7 63,918,658 (GRCm39) missense probably benign 0.05
Z1176:Trpm1 UTSW 7 63,854,342 (GRCm39) critical splice donor site probably null
Z1176:Trpm1 UTSW 7 63,852,879 (GRCm39) critical splice donor site probably null
Z1177:Trpm1 UTSW 7 63,867,439 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- AATACATCTGCTTTTAGGCCGGGG -3'
(R):5'- TTTGGGGAAGCACATCAAGGAACC -3'

Sequencing Primer
(F):5'- GGATATAATTCAACCTGTCATTCCCG -3'
(R):5'- ACCACATGTTACTCTGGGAGG -3'
Posted On 2013-06-12