Incidental Mutation 'LCD18:Anxa7'
Institutional Source Beutler Lab
Gene Symbol Anxa7
Ensembl Gene ENSMUSG00000021814
Gene Nameannexin A7
Synonymssynexin, Anx7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosomal Location20455260-20480133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20469411 bp
Amino Acid Change Glycine to Glutamic Acid at position 113 (G113E)
Ref Sequence ENSEMBL: ENSMUSP00000153669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065504] [ENSMUST00000100844] [ENSMUST00000224975] [ENSMUST00000225132] [ENSMUST00000225941]
Predicted Effect probably damaging
Transcript: ENSMUST00000065504
AA Change: G113E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066035
Gene: ENSMUSG00000021814
AA Change: G113E

low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100844
AA Change: G113E

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098405
Gene: ENSMUSG00000021814
AA Change: G113E

low complexity region 3 21 N/A INTRINSIC
low complexity region 37 103 N/A INTRINSIC
low complexity region 111 129 N/A INTRINSIC
ANX 177 229 5.92e-26 SMART
ANX 249 301 3.12e-25 SMART
ANX 333 385 1.03e-11 SMART
ANX 408 460 2e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223681
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224410
Predicted Effect probably damaging
Transcript: ENSMUST00000224975
AA Change: G113E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225118
Predicted Effect probably benign
Transcript: ENSMUST00000225132
Predicted Effect probably benign
Transcript: ENSMUST00000225941
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VII is a member of the annexin family of calcium-dependent phospholipid binding proteins.The Annexin VII gene contains 14 exons and spans approximately 34 kb of DNA. An alternatively spliced cassette exon results in two mRNA transcripts of 2.0 and 2.4 kb which are predicted to generate two protein isoforms differing in their N-terminal domain. The alternative splicing event is tissue specific and the mRNA containing the cassette exon is prevalent in brain, heart and skeletal muscle. The transcripts also differ in their 3'-non coding regions by the use of two alternative poly(A) signals. Annexin VII encodes a protein with a molecular weight of approximately 51 kDa with a unique, highly hydrophobic N-terminal domain of 167 amino acids and a conserved C-terminal region of 299 amino acids. The latter domain is composed of alternating hydrophobic and hydrophilic segments. Structural analysis of the protein suggests that Annexin VII is a membrane binding protein with diverse properties, including voltage-sensitive calcium channel activity, ion selectivity and membrane fusion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are viable but exhibit altered Ca2+ signaling and/or homeostasis in cardiomyocytes and glia cells, and changes in erythrocyte shape, osmotic resistance, platelet number and aggregation velocity. Homozygotes for another null allele die at ~E10 with cerebral hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Anxa7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Anxa7 APN 14 20458681 missense possibly damaging 0.87
IGL01137:Anxa7 APN 14 20456580 nonsense probably null
IGL01376:Anxa7 APN 14 20460456 missense probably benign 0.00
IGL01651:Anxa7 APN 14 20456501 missense probably damaging 1.00
IGL02830:Anxa7 APN 14 20456540 missense possibly damaging 0.67
IGL03078:Anxa7 APN 14 20456556 missense probably damaging 0.97
IGL03177:Anxa7 APN 14 20456586 missense probably benign 0.41
FR4449:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4548:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4737:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
FR4976:Anxa7 UTSW 14 20469411 missense probably damaging 0.97
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0049:Anxa7 UTSW 14 20462610 missense probably damaging 1.00
R0121:Anxa7 UTSW 14 20460159 missense probably damaging 0.97
R0329:Anxa7 UTSW 14 20469498 splice site probably null
R0330:Anxa7 UTSW 14 20469498 splice site probably null
R1416:Anxa7 UTSW 14 20462707 missense probably damaging 1.00
R1601:Anxa7 UTSW 14 20464615 nonsense probably null
R1701:Anxa7 UTSW 14 20460161 missense probably damaging 1.00
R1794:Anxa7 UTSW 14 20471467 missense unknown
R1828:Anxa7 UTSW 14 20462664 missense probably damaging 1.00
R4676:Anxa7 UTSW 14 20467915 missense probably benign 0.00
R5354:Anxa7 UTSW 14 20464909 missense possibly damaging 0.63
R6547:Anxa7 UTSW 14 20469393 missense probably benign 0.13
R6985:Anxa7 UTSW 14 20471568 missense unknown
R7226:Anxa7 UTSW 14 20460195 missense probably damaging 0.97
R7267:Anxa7 UTSW 14 20469406 missense probably benign 0.05
R7811:Anxa7 UTSW 14 20460186 missense probably benign
R8550:Anxa7 UTSW 14 20456525 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-05-17