Incidental Mutation 'LCD18:Dnah12'
ID478061
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Namedynein, axonemal, heavy chain 12
SynonymsDHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #LCD18 (G1)
Quality Score999
Status Validated
Chromosome14
Chromosomal Location26693274-26891703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26849385 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 2817 (G2817V)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: G2817V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: G2817V

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165269
AA Change: G197V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130609
Gene: ENSMUSG00000021879
AA Change: G197V

DomainStartEndE-ValueType
Pfam:MT 1 248 5.7e-40 PFAM
Pfam:AAA_9 270 495 3.8e-96 PFAM
low complexity region 593 606 N/A INTRINSIC
Pfam:Dynein_heavy 631 1336 2e-287 PFAM
Meta Mutation Damage Score 0.2993 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
C530008M17Rik GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG GGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 5: 76,658,742 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnm3 CATATATATATATATATATATATA CATATATATATATATATATATA 1: 162,406,561 probably benign Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm22194 AGTGTGTGTGTGTGTGTGTGTGTGTGTGTG AGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG 10: 11,940,963 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm35048 GACACACACACACACACACACACACACACACACACACAC GACACACACACACACACACACACACACACACACACAC 1: 90,521,526 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm37928 AACACACACACACACACACACACACACACACACA AACACACACACACACACACACACACACACACACACA 3: 118,534,557 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Marc2 TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA TAGGCAGCCAATCAGAGCACTGCCTCTCAGCGCCAGGCA 1: 184,822,788 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zdhhc3 AACACACACACACACACACACACACACACACAC AACACACACACACACACACACACACACACACACAC 9: 123,083,022 probably benign Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26771005 missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26710275 splice site probably benign
IGL01681:Dnah12 APN 14 26722160 missense probably benign
IGL02082:Dnah12 APN 14 26707162 missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26716577 missense probably benign 0.20
IGL02170:Dnah12 APN 14 26773112 missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26706917 missense probably benign 0.00
IGL02367:Dnah12 APN 14 26709161 missense probably benign 0.30
IGL02418:Dnah12 APN 14 26773722 missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26724512 missense probably benign 0.02
IGL03066:Dnah12 APN 14 26697398 missense probably benign 0.06
drippings UTSW 14 26854804 missense probably damaging 1.00
grueben UTSW 14 26878079 missense probably damaging 1.00
F5770:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26849385 missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26872740 missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26772644 missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26799999 missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26706117 intron probably null
R0364:Dnah12 UTSW 14 26724473 missense probably benign 0.10
R0469:Dnah12 UTSW 14 26798899 missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26709310 missense probably benign 0.00
R0709:Dnah12 UTSW 14 26884265 splice site probably benign
R0734:Dnah12 UTSW 14 26800013 missense probably benign 0.00
R1273:Dnah12 UTSW 14 26739220 nonsense probably null
R1496:Dnah12 UTSW 14 26710248 missense probably benign
R1503:Dnah12 UTSW 14 26773692 missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26816322 missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26766190 missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26778883 missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26766114 missense probably benign 0.02
R1826:Dnah12 UTSW 14 26711019 missense probably benign 0.01
R1829:Dnah12 UTSW 14 26773023 missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26800075 missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26697398 missense probably benign 0.06
R1862:Dnah12 UTSW 14 26709257 missense probably benign 0.30
R1913:Dnah12 UTSW 14 26792264 splice site probably null
R1933:Dnah12 UTSW 14 26734495 missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26814459 missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26781528 missense probably null 1.00
R2113:Dnah12 UTSW 14 26766141 missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26724458 nonsense probably null
R2126:Dnah12 UTSW 14 26724458 nonsense probably null
R2207:Dnah12 UTSW 14 26781787 missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26739330 missense probably benign 0.06
R2511:Dnah12 UTSW 14 26769950 missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26693470 missense probably benign 0.04
R2875:Dnah12 UTSW 14 26876950 missense probably benign 0.05
R3551:Dnah12 UTSW 14 26770972 missense probably benign 0.01
R3713:Dnah12 UTSW 14 26812790 missense probably benign
R3729:Dnah12 UTSW 14 26706065 missense probably benign 0.02
R3799:Dnah12 UTSW 14 26770923 missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26710211 missense probably benign 0.00
R3892:Dnah12 UTSW 14 26856616 missense probably benign 0.03
R3921:Dnah12 UTSW 14 26771051 missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26723599 missense probably benign
R4065:Dnah12 UTSW 14 26770448 missense probably benign 0.02
R4113:Dnah12 UTSW 14 26693567 missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26709186 missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4260:Dnah12 UTSW 14 26798926 missense probably benign 0.01
R4348:Dnah12 UTSW 14 26814541 missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26815507 missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26734603 missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26871855 missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26770022 missense probably damaging 0.97
R4523:Dnah12 UTSW 14 26876958 missense possibly damaging 0.83
R4546:Dnah12 UTSW 14 26773014 missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26772594 missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26735758 missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26706839 missense probably benign 0.00
R4727:Dnah12 UTSW 14 26872317 missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26781784 missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26716629 nonsense probably null
R4879:Dnah12 UTSW 14 26718046 critical splice donor site probably null
R4893:Dnah12 UTSW 14 26710170 missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26734570 missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26861805 nonsense probably null
R4939:Dnah12 UTSW 14 26891524 missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26716700 missense probably benign 0.00
R5011:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5013:Dnah12 UTSW 14 26710171 missense probably benign 0.03
R5043:Dnah12 UTSW 14 26884190 missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26735697 missense probably benign 0.09
R5122:Dnah12 UTSW 14 26718000 missense probably benign 0.00
R5135:Dnah12 UTSW 14 26770477 missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26850926 nonsense probably null
R5154:Dnah12 UTSW 14 26849363 missense probably benign 0.12
R5206:Dnah12 UTSW 14 26769985 missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26693486 missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26773830 missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26879738 missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26814537 missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26774342 splice site probably null
R5389:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26859299 missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26771050 missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26710269 missense probably benign 0.01
R5681:Dnah12 UTSW 14 26815495 missense probably benign 0.32
R5824:Dnah12 UTSW 14 26770518 critical splice donor site probably null
R5863:Dnah12 UTSW 14 26854921 missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26706884 missense probably benign 0.09
R5912:Dnah12 UTSW 14 26770008 nonsense probably null
R5916:Dnah12 UTSW 14 26706918 missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26706867 missense probably benign 0.00
R5987:Dnah12 UTSW 14 26886871 missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26697341 missense probably benign 0.04
R6132:Dnah12 UTSW 14 26717911 missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26875270 missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26773685 missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26861769 missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26710257 missense probably benign 0.03
R6235:Dnah12 UTSW 14 26854804 missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26770482 missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26717974 missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26706834 missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26878051 missense probably benign 0.06
R6480:Dnah12 UTSW 14 26872455 missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26735710 missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26735692 missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26872749 missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26796223 missense probably benign 0.02
R6745:Dnah12 UTSW 14 26707228 missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26801513 missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26735749 missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26878079 missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26799076 intron probably null
R7001:Dnah12 UTSW 14 26879724 missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26876998 missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26735680 missense probably benign
R7107:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7108:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7121:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7122:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7135:Dnah12 UTSW 14 26801413 missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26861732 missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26814413 missense probably benign 0.04
R7201:Dnah12 UTSW 14 26814622 missense probably benign 0.08
R7202:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7204:Dnah12 UTSW 14 26781485 missense probably damaging 0.99
R7205:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7206:Dnah12 UTSW 14 26778912 critical splice donor site probably null
R7219:Dnah12 UTSW 14 26854880 missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26766577 splice site probably null
R7339:Dnah12 UTSW 14 26872320 missense probably benign
R7363:Dnah12 UTSW 14 26724611 missense probably benign
R7426:Dnah12 UTSW 14 26724626 missense probably benign 0.01
R7472:Dnah12 UTSW 14 26856635 missense probably benign 0.01
R7579:Dnah12 UTSW 14 26770503 missense probably benign 0.05
R7655:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7656:Dnah12 UTSW 14 26859316 missense probably benign 0.21
R7694:Dnah12 UTSW 14 26781380 missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26785933 missense probably damaging 1.00
V7580:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26773093 missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26814480 missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26816288 missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26814645 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGTTGTGGCTCCAAAGAAAGC -3'
(R):5'- ACACTGATCTTGCTCCCTTGAG -3'

Sequencing Primer
(F):5'- CCTTAGCAGAGACAATGGAGCTTTTG -3'
(R):5'- TCCCTTGAGAGTCCTAGCCAG -3'
Posted On2017-05-17