Incidental Mutation 'LCD18:Col2a1'
Institutional Source Beutler Lab
Gene Symbol Col2a1
Ensembl Gene ENSMUSG00000022483
Gene Namecollagen, type II, alpha 1
SynonymsM100856, Col2a, Col2a-1, Del1, Col2, Rgsc856, Lpk
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #LCD18 (G1)
Quality Score999
Status Not validated
Chromosomal Location97975602-98004695 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) C to A at 97988981 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000085693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023123] [ENSMUST00000088355] [ENSMUST00000131560]
Predicted Effect probably null
Transcript: ENSMUST00000023123
SMART Domains Protein: ENSMUSP00000023123
Gene: ENSMUSG00000022483

signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
Pfam:Collagen 115 175 1.3e-11 PFAM
Pfam:Collagen 199 260 7.2e-11 PFAM
Pfam:Collagen 258 317 1.3e-12 PFAM
Pfam:Collagen 312 377 4e-9 PFAM
low complexity region 395 411 N/A INTRINSIC
low complexity region 416 451 N/A INTRINSIC
internal_repeat_5 456 468 5.45e-5 PROSPERO
low complexity region 471 513 N/A INTRINSIC
internal_repeat_3 516 619 3.99e-13 PROSPERO
internal_repeat_1 524 567 1.6e-17 PROSPERO
low complexity region 621 633 N/A INTRINSIC
low complexity region 636 655 N/A INTRINSIC
low complexity region 659 687 N/A INTRINSIC
low complexity region 696 753 N/A INTRINSIC
internal_repeat_5 756 768 5.45e-5 PROSPERO
low complexity region 783 804 N/A INTRINSIC
Pfam:Collagen 852 918 1.1e-8 PFAM
Pfam:Collagen 876 941 1.9e-9 PFAM
Pfam:Collagen 900 966 2.4e-9 PFAM
Pfam:Collagen 983 1049 2.1e-10 PFAM
low complexity region 1062 1081 N/A INTRINSIC
Pfam:Collagen 1101 1172 3.4e-9 PFAM
Pfam:Collagen 1158 1218 1.3e-9 PFAM
COLFI 1252 1487 3.06e-184 SMART
Predicted Effect probably null
Transcript: ENSMUST00000088355
SMART Domains Protein: ENSMUSP00000085693
Gene: ENSMUSG00000022483

signal peptide 1 25 N/A INTRINSIC
Pfam:Collagen 47 107 1.2e-11 PFAM
Pfam:Collagen 131 192 7.2e-11 PFAM
Pfam:Collagen 190 249 1.3e-12 PFAM
low complexity region 262 314 N/A INTRINSIC
Pfam:Collagen 327 405 3.5e-7 PFAM
Pfam:Collagen 361 429 7.6e-10 PFAM
internal_repeat_3 448 551 1.3e-13 PROSPERO
internal_repeat_7 454 466 2.86e-5 PROSPERO
internal_repeat_1 456 499 4.05e-18 PROSPERO
internal_repeat_6 481 504 1.7e-5 PROSPERO
low complexity region 553 565 N/A INTRINSIC
low complexity region 568 587 N/A INTRINSIC
low complexity region 591 619 N/A INTRINSIC
low complexity region 628 685 N/A INTRINSIC
internal_repeat_4 688 712 8.3e-12 PROSPERO
low complexity region 715 736 N/A INTRINSIC
low complexity region 747 784 N/A INTRINSIC
Pfam:Collagen 808 878 9.8e-9 PFAM
Pfam:Collagen 832 898 2.1e-9 PFAM
Pfam:Collagen 916 979 7.2e-10 PFAM
Pfam:Collagen 937 1005 2.1e-8 PFAM
Pfam:Collagen 973 1049 6e-7 PFAM
Pfam:Collagen 1030 1094 1.5e-10 PFAM
Pfam:Collagen 1088 1150 1.4e-9 PFAM
COLFI 1184 1419 3.06e-184 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131560
SMART Domains Protein: ENSMUSP00000116951
Gene: ENSMUSG00000022483

signal peptide 1 25 N/A INTRINSIC
VWC 34 88 1.59e-21 SMART
low complexity region 109 132 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131910
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type II collagen, the major component of cartilage and the vitreous humor of the eye. The encoded preproprotein forms homotrimeric, triple helical procollagen that undergoes proteolytic processing during fibirl formation. Mice harboring certain mutations in this gene exhibit severe chondrodysplasia characterized by short limbs and trunch, craniofacial deformities and cleft palate. A complete lack of the encoded protein in mice results in postnatal lethality. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mutations in this locus affect cartilage development. Homozygotes die perinatally with anomalies such as shortened limbs without epiphiseal growth plates, cleft palate and persistence of notochord. Heterozygotes are dwarfed with reduced cartilage matrix. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Olfr313 T A 11: 58,817,440 V144D possibly damaging Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Col2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Col2a1 APN 15 97976173 missense unknown
IGL01286:Col2a1 APN 15 97994878 missense unknown
IGL01369:Col2a1 APN 15 97977826 missense unknown
IGL01747:Col2a1 APN 15 97991392 splice site probably benign
IGL02086:Col2a1 APN 15 97986737 splice site probably null
IGL02549:Col2a1 APN 15 97977799 missense unknown
IGL03289:Col2a1 APN 15 97980881 missense unknown
IGL03369:Col2a1 APN 15 97982042 missense unknown
FR4304:Col2a1 UTSW 15 97988981 synonymous probably null
FR4340:Col2a1 UTSW 15 97988981 synonymous probably null
FR4342:Col2a1 UTSW 15 97988981 synonymous probably null
FR4589:Col2a1 UTSW 15 97988981 synonymous probably null
R0124:Col2a1 UTSW 15 97998862 missense unknown
R0227:Col2a1 UTSW 15 97976755 missense unknown
R0690:Col2a1 UTSW 15 97980192 missense unknown
R1434:Col2a1 UTSW 15 97979651 missense probably damaging 0.96
R1473:Col2a1 UTSW 15 97982908 splice site probably benign
R1577:Col2a1 UTSW 15 97979202 missense probably damaging 1.00
R1598:Col2a1 UTSW 15 97979250 missense probably damaging 0.99
R1837:Col2a1 UTSW 15 97996641 splice site probably benign
R2153:Col2a1 UTSW 15 97987580 missense unknown
R2965:Col2a1 UTSW 15 97976095 missense unknown
R2966:Col2a1 UTSW 15 97976095 missense unknown
R3710:Col2a1 UTSW 15 97990907 splice site probably benign
R3838:Col2a1 UTSW 15 97988976 missense unknown
R3838:Col2a1 UTSW 15 98000581 intron probably benign
R4112:Col2a1 UTSW 15 97983701 missense probably benign 0.18
R4417:Col2a1 UTSW 15 97998585 missense unknown
R4656:Col2a1 UTSW 15 97976176 missense unknown
R4960:Col2a1 UTSW 15 97976149 missense unknown
R5008:Col2a1 UTSW 15 97979669 missense probably benign 0.28
R5435:Col2a1 UTSW 15 98000510 intron probably benign
R5473:Col2a1 UTSW 15 97987489 missense unknown
R6042:Col2a1 UTSW 15 98000570 intron probably benign
R6118:Col2a1 UTSW 15 97998567 missense unknown
R6183:Col2a1 UTSW 15 97988790 missense unknown
R6187:Col2a1 UTSW 15 97988790 missense unknown
R6401:Col2a1 UTSW 15 97985892 missense unknown
R6550:Col2a1 UTSW 15 97976793 missense unknown
R6568:Col2a1 UTSW 15 97977276 missense unknown
R6988:Col2a1 UTSW 15 98004454 missense unknown
R7060:Col2a1 UTSW 15 97976141 missense unknown
R7069:Col2a1 UTSW 15 97998588 missense unknown
R7167:Col2a1 UTSW 15 98000456 missense unknown
R7294:Col2a1 UTSW 15 97987287 splice site probably null
R7392:Col2a1 UTSW 15 97980151 nonsense probably null
R7491:Col2a1 UTSW 15 97976159 missense not run
R7583:Col2a1 UTSW 15 97976184 missense unknown
R7665:Col2a1 UTSW 15 97976700 missense unknown
R7872:Col2a1 UTSW 15 98000577 nonsense probably null
R7955:Col2a1 UTSW 15 98000577 nonsense probably null
Z1177:Col2a1 UTSW 15 97983973 missense not run
Z1177:Col2a1 UTSW 15 97998345 missense not run
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-05-17